ID: 944465183

View in Genome Browser
Species Human (GRCh38)
Location 2:199993603-199993625
Sequence GTGGAAGGGGGAAATTGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944465177_944465183 -6 Left 944465177 2:199993586-199993608 CCTCCATAAGTCTCTCTGTGGAA No data
Right 944465183 2:199993603-199993625 GTGGAAGGGGGAAATTGACGAGG No data
944465179_944465183 -9 Left 944465179 2:199993589-199993611 CCATAAGTCTCTCTGTGGAAGGG No data
Right 944465183 2:199993603-199993625 GTGGAAGGGGGAAATTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944465183 Original CRISPR GTGGAAGGGGGAAATTGACG AGG Intronic
No off target data available for this crispr