ID: 944466876

View in Genome Browser
Species Human (GRCh38)
Location 2:200010809-200010831
Sequence AGGTGGCCCCTGCACTTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944466874_944466876 -5 Left 944466874 2:200010791-200010813 CCTGGGAATCACAGTCTCAGGTG 0: 1
1: 0
2: 0
3: 21
4: 197
Right 944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG 0: 1
1: 0
2: 0
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944466876 Original CRISPR AGGTGGCCCCTGCACTTTCA CGG Intergenic
900524109 1:3120103-3120125 AGGTGGCCCCTGAGCTTCCGTGG + Intronic
900559763 1:3298210-3298232 AAGTGTCCCCTGCACACTCAGGG - Intronic
901655347 1:10766103-10766125 CAGTGGCCCCTGCATTTTCTGGG - Intronic
901675336 1:10880111-10880133 ATGTGGCTCCTGCCCTTCCAGGG - Intergenic
901784261 1:11614148-11614170 TGGTGGCCCTTGCAGTCTCAGGG - Intergenic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
904280866 1:29417372-29417394 TTGTGACCCCTGCACTTCCAGGG - Intergenic
907305358 1:53509970-53509992 CGGTGGCCCCAGCCCCTTCAGGG + Exonic
910150035 1:84131836-84131858 GGGAGGCCCCCACACTTTCATGG + Intronic
912459319 1:109820471-109820493 GGGTGGTCCCTGCCCTTTGAGGG + Intergenic
915267982 1:154732340-154732362 AGGTGTGCCGTGCCCTTTCAAGG - Intronic
916246770 1:162696390-162696412 AGGGGGGCCCTGGCCTTTCAGGG - Intronic
917962884 1:180158396-180158418 AGGAGCCCACTGCACGTTCATGG + Intronic
918146817 1:181763893-181763915 AGATGTCCTCTGCATTTTCAGGG + Intronic
918941307 1:191001507-191001529 AGGTTGCCTGTTCACTTTCATGG + Intergenic
920610043 1:207426844-207426866 ATGTGGTCCCTGAACTTTTATGG + Intergenic
924323763 1:242875078-242875100 AGGTGTCCCCTGCAATTTGAGGG - Intergenic
1065468870 10:26055567-26055589 AGGTGGCCTCCGTACTTTTATGG + Intronic
1065615179 10:27513768-27513790 AGGGGGGCCTTGCAGTTTCATGG - Intronic
1069574464 10:69516923-69516945 CTGTGGCCCCTGCACTGTCTGGG + Intergenic
1070607304 10:77907999-77908021 AGGTGGCTGCTGCAGGTTCATGG - Intronic
1070617134 10:77977808-77977830 AGGGGGATTCTGCACTTTCAGGG + Intronic
1070945351 10:80386805-80386827 GGCTGGCCCCCACACTTTCATGG - Intergenic
1072631330 10:97148977-97148999 CGGTGTGCCCTGCACTTACAGGG - Intronic
1075926109 10:126252929-126252951 AGGTGGCACTTGCAACTTCATGG + Intronic
1076177194 10:128377205-128377227 AGGTGTCACCTGCATTTACAGGG + Intergenic
1077958433 11:7047107-7047129 AGGTCACCAATGCACTTTCAAGG + Intronic
1078444731 11:11395603-11395625 AAGTGGCCACTGCACTTGAAGGG + Intronic
1079628212 11:22641569-22641591 AGGAGGCCCCTACAGTTGCAAGG - Intronic
1080808538 11:35679234-35679256 AAGTGGTCTCTGCACTTTCATGG - Intronic
1081573151 11:44303748-44303770 AGGGGGCCGCTGCCCTTTCCTGG + Intronic
1083328054 11:61883674-61883696 AGGTGGCCCCAGAACTGACATGG - Intronic
1085290960 11:75399206-75399228 CTCTGGCCCCTACACTTTCAGGG - Intergenic
1089146135 11:116330853-116330875 AGGTGGCCCAGGCTCCTTCAGGG - Intergenic
1089302550 11:117507407-117507429 AGGGCACCCCTGCACTTTCAGGG + Intronic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1090719045 11:129455950-129455972 TAGTGGCCCCTGCAAGTTCAGGG + Intergenic
1091875724 12:3931480-3931502 AGGTGGAGCCCGCACTATCATGG - Intergenic
1102768276 12:115451873-115451895 AGGCGGCCCCGGCAAGTTCACGG + Intergenic
1105930248 13:25045875-25045897 TGGTGGCCTTTGCTCTTTCAAGG - Intergenic
1107225941 13:38047253-38047275 ACTTAGCCCCTTCACTTTCAAGG - Intergenic
1111952062 13:94716475-94716497 ATTTGGCCTCTGCACTTTGAAGG - Intergenic
1112036054 13:95497653-95497675 AAATGTCCCCTGCAATTTCAGGG + Intronic
1112331824 13:98482808-98482830 AGGCGGCCCCTCCACTCACAGGG - Intronic
1116637255 14:47412800-47412822 ATGTTGCCCATGCAATTTCAAGG + Intronic
1117213635 14:53527326-53527348 AGGTGGCCCCTTCAGTTTAATGG - Intergenic
1117611996 14:57493527-57493549 AGGTGGCAGCTGCCCTTCCAAGG + Exonic
1118105244 14:62651228-62651250 AGTTGGCCCCTGCACAATGAGGG - Intergenic
1118524487 14:66623769-66623791 AGGAGGGACCTGAACTTTCATGG + Intronic
1120844999 14:89117672-89117694 ATGTGTCCCCTGCATTTCCAGGG - Intergenic
1121674954 14:95744889-95744911 AAGTGGCCTCTGCCCTTTAAGGG - Intergenic
1122857933 14:104568861-104568883 GGGTGGGCCCTGCACCTTCAGGG + Intronic
1123133578 14:106007528-106007550 AGCTGGTGCCTGCACTTTCCAGG - Intergenic
1123134809 14:106017946-106017968 AGCTGGTGCCTGCACTTTCCAGG - Intergenic
1123135968 14:106027502-106027524 AGCTGGTGCCTGCACTTTCCAGG - Intergenic
1123583600 15:21737974-21737996 AGCTGGTGCCTGCACTTTCCAGG - Intergenic
1123620250 15:22180577-22180599 AGCTGGTGCCTGCACTTTCCAGG - Intergenic
1123911879 15:24976385-24976407 GGGTGGCCCCTCCACAGTCATGG - Exonic
1124252916 15:28118862-28118884 AGGTGGCTCCTTCCCGTTCAGGG - Intronic
1131020351 15:89092641-89092663 AAGTGGTCCCTGAACTTCCAAGG + Intronic
1131665599 15:94568197-94568219 AGGTGGACCCTGCCCTTAAAGGG + Intergenic
1132762808 16:1519164-1519186 AGGTGGACCGTGCCCTTCCAAGG + Intronic
1138379413 16:56589868-56589890 AGGTGGCTCCTGCACCTGCGCGG + Exonic
1142899316 17:3002563-3002585 AGCTGGCCCCTGCAGGCTCAGGG + Intronic
1145305674 17:21673824-21673846 AGGCAGCCCCTGAATTTTCAGGG + Intergenic
1150631346 17:66882566-66882588 AGGTGACCTGTGCATTTTCATGG + Intronic
1151099597 17:71541645-71541667 AGGTAGCCCCTGGAGTTCCAAGG + Intergenic
1151141404 17:71995952-71995974 AGATGGGTCCTGCAGTTTCAAGG - Intergenic
1153041123 18:813186-813208 CTGTGGCTCCTCCACTTTCAGGG - Intergenic
1155228736 18:23753215-23753237 TGGTGGCCCCTCCAGTCTCAGGG + Intronic
1155635529 18:27950543-27950565 AGGTGTCCACTGCAGTTTCCAGG + Intergenic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1156496190 18:37526738-37526760 AAGGGGTCCCTGCACTTTCTGGG + Intronic
1157497037 18:48163417-48163439 AGATGGGCCCTGCACTCTCCAGG - Intronic
1160046596 18:75392299-75392321 TGGTGGCTCCAGCTCTTTCATGG + Intergenic
1160782034 19:881927-881949 AGGTGGGCCCTGGGATTTCATGG + Intronic
1160823684 19:1069584-1069606 GAGTGGCCTCTGCACCTTCAGGG + Intronic
1161249978 19:3275385-3275407 TGATGGTCCCCGCACTTTCACGG - Intronic
1161505942 19:4643526-4643548 AGCTGGCCCCTGCCCATCCATGG + Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163948789 19:20565342-20565364 TGGTGGTCCCTGCACATTCTGGG + Intronic
1165749904 19:38253322-38253344 AGCTGGCTTCTGCCCTTTCAAGG + Intronic
1168137188 19:54359665-54359687 GGGTGGCCCCTGCCCCTTCATGG + Intronic
1168160888 19:54509420-54509442 GGGTGGCCCCTGCCCCTTCATGG - Intronic
925073026 2:986216-986238 GGATGGCCCCTGTACTCTCATGG + Intronic
926151418 2:10427655-10427677 CCGTGGCCCCTGCACTCTCCAGG + Intergenic
926347756 2:11964149-11964171 ATGTGGCTCCTGCCCTATCAGGG + Intergenic
927158468 2:20236102-20236124 AGATGGCCCTGGCCCTTTCAGGG - Intergenic
927401433 2:22716403-22716425 AGGGGTCCCCCACACTTTCATGG + Intergenic
927848712 2:26485636-26485658 AGGTGGGCACTGAACTCTCAGGG + Intronic
930907794 2:56593955-56593977 AGGTGGCCTCTTCACTCTGATGG + Intergenic
931790653 2:65660886-65660908 AGAGGGCCCCTGCATTTTAACGG + Intergenic
931898973 2:66766831-66766853 CTGTGACCCCTTCACTTTCAAGG + Intergenic
932864582 2:75328132-75328154 ATGTGGCGCCTGAACCTTCATGG + Intergenic
933805718 2:85997057-85997079 TGGTGCCCCCTCCACTCTCAAGG - Intergenic
934568064 2:95351500-95351522 AGATGGCCACTGCACCTTCTAGG - Intronic
936229929 2:110691757-110691779 GTGTGGTCACTGCACTTTCATGG + Intergenic
938072031 2:128313729-128313751 AGGTGGGCACTGCACTCTCTGGG + Intronic
942612485 2:177756206-177756228 AGTGGGCCCCTGGTCTTTCAGGG + Intronic
943067307 2:183102101-183102123 AGGTTGCCCATTCACTCTCATGG + Intergenic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
945895259 2:215474111-215474133 AAGTGTCTCCTGCATTTTCATGG - Intergenic
948055923 2:235009295-235009317 AGTTGTCCCCTCCACTTCCAAGG + Intronic
948881626 2:240860717-240860739 AGGTGCCCCATGCCCTGTCATGG - Intergenic
948992115 2:241560527-241560549 AGGTGGCCCCTGCCCTTACGTGG + Intronic
1169061019 20:2660396-2660418 AGGTAGCCCCTGTACTTTCTTGG - Intronic
1171523187 20:25791312-25791334 AGGCAGCCCCTGAATTTTCAGGG + Intronic
1171530930 20:25853292-25853314 AGGCAGCCCCTGAATTTTCAGGG + Intronic
1171553639 20:26064571-26064593 AGGCAGCCCCTGAATTTTCAGGG - Intergenic
1171974956 20:31588276-31588298 AGTTGTCTCCTGCACTTTGAAGG - Intergenic
1175254770 20:57634593-57634615 AGGGGGCCCCCACATTTTCATGG + Intergenic
1175405362 20:58722597-58722619 AGATGGCCCCTGCCCTCCCAGGG + Intergenic
1176100586 20:63362677-63362699 AGGGACCCCCTGCACTTCCACGG + Intronic
1177405300 21:20659085-20659107 AGGTGTCCTCTGCACTCTCAAGG - Intergenic
1177957680 21:27620173-27620195 AGGGGTTCCCTACACTTTCATGG - Intergenic
1178484253 21:33007341-33007363 AGGTTGCCCAGGCAATTTCAGGG + Intergenic
1179052042 21:37896555-37896577 AAGTGGCCTCTGCACCTTCACGG - Intronic
1179092855 21:38283985-38284007 GGGAAGCTCCTGCACTTTCATGG + Intronic
1180960250 22:19759269-19759291 AAGAGGGCCCTGCACTTCCAGGG + Intronic
1181761177 22:25059794-25059816 AGGGGACCCCTGCACTCTCAGGG + Intronic
1183101206 22:35585379-35585401 CGGTGGCTCCTGCCCTTTCCAGG - Intergenic
1183343520 22:37294787-37294809 GAGTGGCCCCTGCTCATTCAAGG - Intronic
1183608951 22:38884357-38884379 AGCTGGGCCCAGCACTTTCTCGG - Intergenic
1185019662 22:48366827-48366849 AGGTGGCCACTGCACCGTCCAGG + Intergenic
950859762 3:16137642-16137664 TGGTGCCCCCAGCACTTTCTAGG - Intergenic
951835562 3:26979739-26979761 AAGTGGCCCCTACCCTTCCATGG - Intergenic
953373962 3:42413122-42413144 AGGAGGCCCCTGCACCATGAGGG - Intergenic
954605232 3:51904373-51904395 AGGTGGCCACTGCACAAGCATGG + Intergenic
954749989 3:52808037-52808059 ACGTGGCCACTGGCCTTTCAGGG - Intronic
955026336 3:55171279-55171301 ATATGGCCCCTGCACTGTCCTGG - Intergenic
955109667 3:55935828-55935850 AGGTGCCCTCTGCAACTTCAAGG + Intronic
959002843 3:100984800-100984822 ATGTGCCTCCTGCACTTTCGGGG + Intronic
959174546 3:102889907-102889929 AGGAAGCCCCTGCACTTTCCTGG - Intergenic
964048362 3:152359598-152359620 AGCTGGCTCCTGCACATTCCTGG + Intronic
965924385 3:173959036-173959058 AGGTGCCCCCTTCCCTTGCAGGG - Intronic
968453599 4:686480-686502 CGGGGGCCCCTGCACTGTCCCGG + Intronic
968506372 4:973119-973141 AGGTGGCACCGGCGCTTTCGGGG - Intronic
969073958 4:4562212-4562234 AGGCAGCTCCTGCACTGTCAGGG - Intergenic
972164534 4:36266501-36266523 AGATGGACCCTGCAGTTTTAAGG - Intergenic
973174382 4:47186536-47186558 AAATGGCCCATGCACTTTCCAGG + Intronic
976055912 4:81066727-81066749 AAATGGCCCCAGCACTTTCCAGG - Intergenic
977516739 4:98030056-98030078 AAGAGGCCCCTGAAATTTCATGG + Intronic
979791941 4:124794711-124794733 AGGTGGTCCCTTCATTTTAAGGG + Intergenic
981926956 4:150150970-150150992 AGCTGGCACCTGCTCTTGCAGGG + Intronic
985403204 4:189612413-189612435 AGGTGGCACCTGCAGCTGCAGGG + Intergenic
987986136 5:25148680-25148702 AGGTTGTCCCTTCACTTTCTTGG - Intergenic
988640786 5:33039024-33039046 AAGGGGCTCCTGCTCTTTCATGG + Intergenic
991636540 5:68711392-68711414 CGTGGGCCCCTGCACTTTCCTGG - Intergenic
992993299 5:82307465-82307487 AGGTGGACACTGCACACTCAGGG - Intronic
996234511 5:121108937-121108959 AGGCGGCCCCTGCCCTTGCAAGG - Intergenic
997261206 5:132466687-132466709 AGGCGGCCCCAGGACCTTCAAGG - Intronic
998214484 5:140227077-140227099 AGGTGGCCCCTGGAGCATCATGG + Intronic
999128819 5:149266988-149267010 CTGTGGCCCCTCCACTTGCATGG + Intergenic
999310806 5:150550725-150550747 AGGTGGCCCCTTCTCCCTCAAGG - Intronic
1001086970 5:168707537-168707559 AGCTGGAACCAGCACTTTCAAGG + Intronic
1003244632 6:4373600-4373622 AGGTGGCCCCTGCATCTGGATGG + Intergenic
1004267757 6:14164021-14164043 ACGGGTCCCCTGCATTTTCAAGG - Intergenic
1010682275 6:78810691-78810713 AGGTGGACCCTGCCTTTTTAGGG - Intergenic
1012937236 6:105380744-105380766 GGCTGGCTCCTGCACTTCCACGG + Intronic
1017518009 6:155174940-155174962 AGGTGGGGCCTGCACCTTTAAGG + Intronic
1019161118 6:170067401-170067423 AGCTGCACCCTGCACTTACACGG + Intergenic
1021784739 7:24140706-24140728 AGGTGGCCCTTGCACCCACATGG + Intergenic
1022834879 7:34103855-34103877 AGGTGGCCCTTGCACCTCCAGGG - Intronic
1023200105 7:37687792-37687814 AGATGACCCCTGCACTTCCCTGG + Intronic
1024348356 7:48336494-48336516 TGGTGGGCCCTGCAATTTAATGG + Intronic
1025283626 7:57646221-57646243 AGGTAGCCCCTGAATTTTCAGGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028194969 7:87895635-87895657 AGGTAAGCCCTGCACTTGCATGG + Intronic
1030449965 7:109696355-109696377 AGAGGGCCCCCACACTTTCATGG + Intergenic
1032467549 7:132155731-132155753 AGGTGGGCCCTGCGGTTTCTGGG + Intronic
1034032071 7:147778557-147778579 AGGTAGCACCTGTAGTTTCATGG + Intronic
1034431173 7:151041888-151041910 TGGTGGCCCCTCCAGTTTCTGGG + Intronic
1034981677 7:155482996-155483018 ATGTGCCCCCTGCACTCCCAGGG - Intronic
1035640306 8:1179689-1179711 AGGTGGCCCCTGATATTCCAGGG - Intergenic
1037862284 8:22414035-22414057 CGGTGGCTCATGCACTTTAAAGG - Intronic
1039640065 8:39209877-39209899 AGGTGATACATGCACTTTCATGG + Intronic
1040014745 8:42691273-42691295 ACGTGGCCCCAGCAGTTTGATGG + Intergenic
1040533850 8:48288925-48288947 AGGATGCCCCTGCTCTTCCATGG + Intergenic
1042188739 8:66164469-66164491 AGGTGGCCTCTGCAGTTTTGTGG - Intronic
1042963238 8:74324285-74324307 TGCTGGCCCCTGGATTTTCATGG - Intronic
1043142420 8:76606452-76606474 AGGTGACCCATGTACTCTCAAGG - Intergenic
1045020824 8:98042955-98042977 TGGTTGCCCCTTCACTTGCAAGG - Intronic
1046557548 8:115793580-115793602 AGGTGGCCTTTTCACTTTCTTGG - Intronic
1049360957 8:142212443-142212465 AGGTGGCCACTCCCCTCTCAGGG - Intronic
1056812701 9:89776690-89776712 ATGTGGCACCAGCACTTGCAGGG + Intergenic
1057759742 9:97862576-97862598 AGTTTTCCCCTGCCCTTTCATGG - Intergenic
1061101782 9:128497740-128497762 AGGTGGCCAGTGCACTTGCAAGG + Intronic
1061135743 9:128732290-128732312 AGGTGGCCCTGGAATTTTCATGG - Intronic
1061711389 9:132490341-132490363 AGGTGGCCCCTGTGTTTTGATGG + Intronic
1185729673 X:2451314-2451336 AGGTGGCCTGTGCAGTTCCAGGG - Intronic
1185730374 X:2456696-2456718 AGGTGGCCTGTGCAGTTCCAGGG - Intronic
1185731867 X:2468044-2468066 AGGTGGCCTGTGCAGTTCCAGGG - Intronic
1187278632 X:17838940-17838962 AGGCAGCCCCTGCCCTCTCAGGG + Intronic
1187514367 X:19953598-19953620 ATCTGGCCACTGCACTTTGATGG - Intronic
1192161619 X:68792699-68792721 AGATGGCACCTGAACTTTGACGG + Intergenic
1193875299 X:86855285-86855307 AGGTTGCCTCTTCACTCTCATGG + Intergenic
1196795120 X:119496049-119496071 AGGTAGCCCCTGCTCTTCAAAGG + Intergenic
1197998998 X:132412323-132412345 AGGAGGGCCCTGCATTTCCAGGG + Intronic