ID: 944469901

View in Genome Browser
Species Human (GRCh38)
Location 2:200041786-200041808
Sequence GAAGCATCTTAGTGGCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944469901_944469904 10 Left 944469901 2:200041786-200041808 CCTTACAGCCACTAAGATGCTTC No data
Right 944469904 2:200041819-200041841 ATCCCATAAGCTTATGGAAGAGG No data
944469901_944469903 4 Left 944469901 2:200041786-200041808 CCTTACAGCCACTAAGATGCTTC No data
Right 944469903 2:200041813-200041835 TCTCAAATCCCATAAGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944469901 Original CRISPR GAAGCATCTTAGTGGCTGTA AGG (reversed) Intergenic
No off target data available for this crispr