ID: 944470275

View in Genome Browser
Species Human (GRCh38)
Location 2:200045619-200045641
Sequence AGCCTATGAAGGCAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944470275_944470281 20 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470281 2:200045662-200045684 GTAGATGTATCTACTATTCTGGG No data
944470275_944470282 21 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470282 2:200045663-200045685 TAGATGTATCTACTATTCTGGGG No data
944470275_944470284 29 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470284 2:200045671-200045693 TCTACTATTCTGGGGTTTGGAGG No data
944470275_944470278 -5 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data
944470275_944470283 26 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470283 2:200045668-200045690 GTATCTACTATTCTGGGGTTTGG No data
944470275_944470280 19 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470280 2:200045661-200045683 TGTAGATGTATCTACTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944470275 Original CRISPR AGCCTATGAAGGCAGTTGCA GGG (reversed) Intergenic
No off target data available for this crispr