ID: 944470277

View in Genome Browser
Species Human (GRCh38)
Location 2:200045630-200045652
Sequence CACTCAACACTAGCCTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944470277_944470281 9 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470281 2:200045662-200045684 GTAGATGTATCTACTATTCTGGG No data
944470277_944470284 18 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470284 2:200045671-200045693 TCTACTATTCTGGGGTTTGGAGG No data
944470277_944470282 10 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470282 2:200045663-200045685 TAGATGTATCTACTATTCTGGGG No data
944470277_944470283 15 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470283 2:200045668-200045690 GTATCTACTATTCTGGGGTTTGG No data
944470277_944470286 25 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470286 2:200045678-200045700 TTCTGGGGTTTGGAGGATGGTGG 0: 23
1: 827
2: 1428
3: 1723
4: 1906
944470277_944470280 8 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470280 2:200045661-200045683 TGTAGATGTATCTACTATTCTGG No data
944470277_944470285 22 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470285 2:200045675-200045697 CTATTCTGGGGTTTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944470277 Original CRISPR CACTCAACACTAGCCTATGA AGG (reversed) Intergenic
No off target data available for this crispr