ID: 944470278

View in Genome Browser
Species Human (GRCh38)
Location 2:200045637-200045659
Sequence AGGCTAGTGTTGAGTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944470272_944470278 18 Left 944470272 2:200045596-200045618 CCTGTGGCTCTGCAGGGTACAGC 0: 105
1: 1053
2: 1634
3: 1449
4: 1229
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data
944470271_944470278 19 Left 944470271 2:200045595-200045617 CCCTGTGGCTCTGCAGGGTACAG 0: 110
1: 1120
2: 1573
3: 1295
4: 1089
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data
944470270_944470278 20 Left 944470270 2:200045594-200045616 CCCCTGTGGCTCTGCAGGGTACA 0: 107
1: 1166
2: 1476
3: 1295
4: 958
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data
944470276_944470278 -6 Left 944470276 2:200045620-200045642 CCTGCAACTGCCTTCATAGGCTA No data
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data
944470274_944470278 -4 Left 944470274 2:200045618-200045640 CCCCTGCAACTGCCTTCATAGGC No data
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data
944470275_944470278 -5 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470278 2:200045637-200045659 AGGCTAGTGTTGAGTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944470278 Original CRISPR AGGCTAGTGTTGAGTGCCTG TGG Intergenic
No off target data available for this crispr