ID: 944470282

View in Genome Browser
Species Human (GRCh38)
Location 2:200045663-200045685
Sequence TAGATGTATCTACTATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944470274_944470282 22 Left 944470274 2:200045618-200045640 CCCCTGCAACTGCCTTCATAGGC No data
Right 944470282 2:200045663-200045685 TAGATGTATCTACTATTCTGGGG No data
944470276_944470282 20 Left 944470276 2:200045620-200045642 CCTGCAACTGCCTTCATAGGCTA No data
Right 944470282 2:200045663-200045685 TAGATGTATCTACTATTCTGGGG No data
944470275_944470282 21 Left 944470275 2:200045619-200045641 CCCTGCAACTGCCTTCATAGGCT No data
Right 944470282 2:200045663-200045685 TAGATGTATCTACTATTCTGGGG No data
944470277_944470282 10 Left 944470277 2:200045630-200045652 CCTTCATAGGCTAGTGTTGAGTG No data
Right 944470282 2:200045663-200045685 TAGATGTATCTACTATTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944470282 Original CRISPR TAGATGTATCTACTATTCTG GGG Intergenic
No off target data available for this crispr