ID: 944471301

View in Genome Browser
Species Human (GRCh38)
Location 2:200055930-200055952
Sequence CTGCAGCAGCAGTGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944471301_944471306 6 Left 944471301 2:200055930-200055952 CCCCTCTGCCACTGCTGCTGCAG No data
Right 944471306 2:200055959-200055981 TGCCCTTGCTGCCCTCAAACTGG No data
944471301_944471311 12 Left 944471301 2:200055930-200055952 CCCCTCTGCCACTGCTGCTGCAG No data
Right 944471311 2:200055965-200055987 TGCTGCCCTCAAACTGGGGAAGG No data
944471301_944471309 8 Left 944471301 2:200055930-200055952 CCCCTCTGCCACTGCTGCTGCAG No data
Right 944471309 2:200055961-200055983 CCCTTGCTGCCCTCAAACTGGGG No data
944471301_944471307 7 Left 944471301 2:200055930-200055952 CCCCTCTGCCACTGCTGCTGCAG No data
Right 944471307 2:200055960-200055982 GCCCTTGCTGCCCTCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944471301 Original CRISPR CTGCAGCAGCAGTGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr