ID: 944473413

View in Genome Browser
Species Human (GRCh38)
Location 2:200079819-200079841
Sequence CAAGGTGGACAAAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944473409_944473413 26 Left 944473409 2:200079770-200079792 CCTATATTGTGCTCATTGAGCTA No data
Right 944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944473413 Original CRISPR CAAGGTGGACAAAAGGCAGA AGG Intergenic
No off target data available for this crispr