ID: 944473838

View in Genome Browser
Species Human (GRCh38)
Location 2:200084272-200084294
Sequence TCTACTCTACAGAAATAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944473835_944473838 7 Left 944473835 2:200084242-200084264 CCTGTGTCTGGAGGCATGCAATG No data
Right 944473838 2:200084272-200084294 TCTACTCTACAGAAATAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944473838 Original CRISPR TCTACTCTACAGAAATAGGT GGG Intergenic
No off target data available for this crispr