ID: 944474797

View in Genome Browser
Species Human (GRCh38)
Location 2:200092623-200092645
Sequence CAGTATCCCCACAGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944474791_944474797 -2 Left 944474791 2:200092602-200092624 CCAGGGTCTTTACCCCAGAGCCA No data
Right 944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG No data
944474785_944474797 20 Left 944474785 2:200092580-200092602 CCATGCTCCTATTCACTCTGCCC No data
Right 944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG No data
944474789_944474797 0 Left 944474789 2:200092600-200092622 CCCCAGGGTCTTTACCCCAGAGC No data
Right 944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG No data
944474788_944474797 13 Left 944474788 2:200092587-200092609 CCTATTCACTCTGCCCCAGGGTC No data
Right 944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG No data
944474790_944474797 -1 Left 944474790 2:200092601-200092623 CCCAGGGTCTTTACCCCAGAGCC No data
Right 944474797 2:200092623-200092645 CAGTATCCCCACAGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944474797 Original CRISPR CAGTATCCCCACAGGAAGCC AGG Intergenic
No off target data available for this crispr