ID: 944475844

View in Genome Browser
Species Human (GRCh38)
Location 2:200105156-200105178
Sequence ATGCTTTTATAGCTTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944475844_944475846 8 Left 944475844 2:200105156-200105178 CCTTTTCCAAGCTATAAAAGCAT No data
Right 944475846 2:200105187-200105209 ATTTTATTCTAGTACTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944475844 Original CRISPR ATGCTTTTATAGCTTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr