ID: 944479729

View in Genome Browser
Species Human (GRCh38)
Location 2:200144357-200144379
Sequence CTATCCTCCAGACCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944479729_944479734 21 Left 944479729 2:200144357-200144379 CCACTCTGGGGTCTGGAGGATAG No data
Right 944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG No data
944479729_944479730 4 Left 944479729 2:200144357-200144379 CCACTCTGGGGTCTGGAGGATAG No data
Right 944479730 2:200144384-200144406 TCTCTTATCACATCTTCACTAGG No data
944479729_944479732 19 Left 944479729 2:200144357-200144379 CCACTCTGGGGTCTGGAGGATAG No data
Right 944479732 2:200144399-200144421 TCACTAGGCAGTACCGCAGTGGG No data
944479729_944479731 18 Left 944479729 2:200144357-200144379 CCACTCTGGGGTCTGGAGGATAG No data
Right 944479731 2:200144398-200144420 TTCACTAGGCAGTACCGCAGTGG No data
944479729_944479733 20 Left 944479729 2:200144357-200144379 CCACTCTGGGGTCTGGAGGATAG No data
Right 944479733 2:200144400-200144422 CACTAGGCAGTACCGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944479729 Original CRISPR CTATCCTCCAGACCCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr