ID: 944479734

View in Genome Browser
Species Human (GRCh38)
Location 2:200144401-200144423
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944479729_944479734 21 Left 944479729 2:200144357-200144379 CCACTCTGGGGTCTGGAGGATAG No data
Right 944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr