ID: 944483451

View in Genome Browser
Species Human (GRCh38)
Location 2:200180210-200180232
Sequence TTGGCCACTGAGCGTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944483451_944483455 14 Left 944483451 2:200180210-200180232 CCTGCAGAACGCTCAGTGGCCAA No data
Right 944483455 2:200180247-200180269 ACTCCCCAGGACTTCTCATCTGG No data
944483451_944483454 1 Left 944483451 2:200180210-200180232 CCTGCAGAACGCTCAGTGGCCAA No data
Right 944483454 2:200180234-200180256 AAGCTGTTGGAAGACTCCCCAGG No data
944483451_944483458 18 Left 944483451 2:200180210-200180232 CCTGCAGAACGCTCAGTGGCCAA No data
Right 944483458 2:200180251-200180273 CCCAGGACTTCTCATCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944483451 Original CRISPR TTGGCCACTGAGCGTTCTGC AGG (reversed) Intergenic
No off target data available for this crispr