ID: 944490856

View in Genome Browser
Species Human (GRCh38)
Location 2:200256436-200256458
Sequence CTGTGTCACATGGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944490856_944490867 25 Left 944490856 2:200256436-200256458 CCCACCTCCTCCATGTGACACAG No data
Right 944490867 2:200256484-200256506 CCCCAGCCCCCCAGAAGACGAGG No data
944490856_944490872 28 Left 944490856 2:200256436-200256458 CCCACCTCCTCCATGTGACACAG No data
Right 944490872 2:200256487-200256509 CAGCCCCCCAGAAGACGAGGGGG No data
944490856_944490869 26 Left 944490856 2:200256436-200256458 CCCACCTCCTCCATGTGACACAG No data
Right 944490869 2:200256485-200256507 CCCAGCCCCCCAGAAGACGAGGG No data
944490856_944490871 27 Left 944490856 2:200256436-200256458 CCCACCTCCTCCATGTGACACAG No data
Right 944490871 2:200256486-200256508 CCAGCCCCCCAGAAGACGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944490856 Original CRISPR CTGTGTCACATGGAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr