ID: 944492705

View in Genome Browser
Species Human (GRCh38)
Location 2:200274164-200274186
Sequence AAGAGCAGAGGCTCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944492705_944492708 11 Left 944492705 2:200274164-200274186 CCTGGAGCAGAGCCTCTGCTCTT No data
Right 944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944492705 Original CRISPR AAGAGCAGAGGCTCTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr