ID: 944492706

View in Genome Browser
Species Human (GRCh38)
Location 2:200274176-200274198
Sequence GTACAGCAAATGAAGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944492706_944492711 24 Left 944492706 2:200274176-200274198 CCTCTGCTCTTCATTTGCTGTAC No data
Right 944492711 2:200274223-200274245 ATGAGTTCACTGTGTCTCCCAGG No data
944492706_944492708 -1 Left 944492706 2:200274176-200274198 CCTCTGCTCTTCATTTGCTGTAC No data
Right 944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944492706 Original CRISPR GTACAGCAAATGAAGAGCAG AGG (reversed) Intergenic
No off target data available for this crispr