ID: 944492708

View in Genome Browser
Species Human (GRCh38)
Location 2:200274198-200274220
Sequence CCCCATAAAAACAGCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944492705_944492708 11 Left 944492705 2:200274164-200274186 CCTGGAGCAGAGCCTCTGCTCTT No data
Right 944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG No data
944492706_944492708 -1 Left 944492706 2:200274176-200274198 CCTCTGCTCTTCATTTGCTGTAC No data
Right 944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944492708 Original CRISPR CCCCATAAAAACAGCTATCT TGG Intergenic
No off target data available for this crispr