ID: 944493617

View in Genome Browser
Species Human (GRCh38)
Location 2:200283825-200283847
Sequence GAGCAGTGACCATTGATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944493615_944493617 8 Left 944493615 2:200283794-200283816 CCTTGAGAGGAGCTGTGAGCTTC No data
Right 944493617 2:200283825-200283847 GAGCAGTGACCATTGATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944493617 Original CRISPR GAGCAGTGACCATTGATCAA GGG Intergenic
No off target data available for this crispr