ID: 944495595

View in Genome Browser
Species Human (GRCh38)
Location 2:200305115-200305137
Sequence GAGGATTACCTGAACCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12557
Summary {0: 1, 1: 0, 2: 22, 3: 671, 4: 11863}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944495595_944495602 3 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495602 2:200305141-200305163 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
944495595_944495604 11 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495604 2:200305149-200305171 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
944495595_944495606 30 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495595_944495600 2 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495600 2:200305140-200305162 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944495595 Original CRISPR GAGGATTACCTGAACCAGGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr