ID: 944495600

View in Genome Browser
Species Human (GRCh38)
Location 2:200305140-200305162
Sequence ACCTCAGCCTCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 727067
Summary {0: 12610, 1: 113153, 2: 218440, 3: 237917, 4: 144947}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944495596_944495600 -2 Left 944495596 2:200305119-200305141 CCTGGTTCAGGTAATCCTCCCAC 0: 7
1: 192
2: 2879
3: 12408
4: 28558
Right 944495600 2:200305140-200305162 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
944495595_944495600 2 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495600 2:200305140-200305162 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
944495591_944495600 23 Left 944495591 2:200305094-200305116 CCTGGCTCACTGCAACCTTAGCC 0: 1
1: 86
2: 1801
3: 3891
4: 3730
Right 944495600 2:200305140-200305162 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
944495594_944495600 8 Left 944495594 2:200305109-200305131 CCTTAGCCTACCTGGTTCAGGTA 0: 1
1: 0
2: 0
3: 17
4: 470
Right 944495600 2:200305140-200305162 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944495600 Original CRISPR ACCTCAGCCTCCTGAGTAGC TGG Intergenic
Too many off-targets to display for this crispr