ID: 944495602

View in Genome Browser
Species Human (GRCh38)
Location 2:200305141-200305163
Sequence CCTCAGCCTCCTGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 777919
Summary {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944495595_944495602 3 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495602 2:200305141-200305163 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
944495591_944495602 24 Left 944495591 2:200305094-200305116 CCTGGCTCACTGCAACCTTAGCC 0: 1
1: 86
2: 1801
3: 3891
4: 3730
Right 944495602 2:200305141-200305163 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
944495594_944495602 9 Left 944495594 2:200305109-200305131 CCTTAGCCTACCTGGTTCAGGTA 0: 1
1: 0
2: 0
3: 17
4: 470
Right 944495602 2:200305141-200305163 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
944495596_944495602 -1 Left 944495596 2:200305119-200305141 CCTGGTTCAGGTAATCCTCCCAC 0: 7
1: 192
2: 2879
3: 12408
4: 28558
Right 944495602 2:200305141-200305163 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944495602 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG Intergenic
Too many off-targets to display for this crispr