ID: 944495604

View in Genome Browser
Species Human (GRCh38)
Location 2:200305149-200305171
Sequence TCCTGAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 754630
Summary {0: 40895, 1: 157395, 2: 217955, 3: 208005, 4: 130380}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944495597_944495604 -8 Left 944495597 2:200305134-200305156 CCTCCCACCTCAGCCTCCTGAGT 0: 8323
1: 18792
2: 35855
3: 45986
4: 76012
Right 944495604 2:200305149-200305171 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
944495594_944495604 17 Left 944495594 2:200305109-200305131 CCTTAGCCTACCTGGTTCAGGTA 0: 1
1: 0
2: 0
3: 17
4: 470
Right 944495604 2:200305149-200305171 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
944495596_944495604 7 Left 944495596 2:200305119-200305141 CCTGGTTCAGGTAATCCTCCCAC 0: 7
1: 192
2: 2879
3: 12408
4: 28558
Right 944495604 2:200305149-200305171 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
944495595_944495604 11 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495604 2:200305149-200305171 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944495604 Original CRISPR TCCTGAGTAGCTGGGACTAC AGG Intergenic
Too many off-targets to display for this crispr