ID: 944495606

View in Genome Browser
Species Human (GRCh38)
Location 2:200305168-200305190
Sequence CAGGCGTGCACCACCATGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364360
Summary {0: 1062, 1: 9938, 2: 37549, 3: 109747, 4: 206064}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944495595_944495606 30 Left 944495595 2:200305115-200305137 CCTACCTGGTTCAGGTAATCCTC 0: 1
1: 0
2: 22
3: 671
4: 11863
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495598_944495606 8 Left 944495598 2:200305137-200305159 CCCACCTCAGCCTCCTGAGTAGC 0: 12857
1: 106119
2: 203574
3: 219964
4: 132850
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495599_944495606 7 Left 944495599 2:200305138-200305160 CCACCTCAGCCTCCTGAGTAGCT 0: 12796
1: 27138
2: 40269
3: 37422
4: 31273
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495603_944495606 -2 Left 944495603 2:200305147-200305169 CCTCCTGAGTAGCTGGGACTACA 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495596_944495606 26 Left 944495596 2:200305119-200305141 CCTGGTTCAGGTAATCCTCCCAC 0: 7
1: 192
2: 2879
3: 12408
4: 28558
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495597_944495606 11 Left 944495597 2:200305134-200305156 CCTCCCACCTCAGCCTCCTGAGT 0: 8323
1: 18792
2: 35855
3: 45986
4: 76012
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495601_944495606 4 Left 944495601 2:200305141-200305163 CCTCAGCCTCCTGAGTAGCTGGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064
944495605_944495606 -5 Left 944495605 2:200305150-200305172 CCTGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 944495606 2:200305168-200305190 CAGGCGTGCACCACCATGCCCGG 0: 1062
1: 9938
2: 37549
3: 109747
4: 206064

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944495606 Original CRISPR CAGGCGTGCACCACCATGCC CGG Intergenic
Too many off-targets to display for this crispr