ID: 944497965

View in Genome Browser
Species Human (GRCh38)
Location 2:200327758-200327780
Sequence TTGTGAAAGCAAATGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944497962_944497965 -8 Left 944497962 2:200327743-200327765 CCCTCCAAGGAGTTTTTGTGAAA 0: 1
1: 0
2: 1
3: 14
4: 207
Right 944497965 2:200327758-200327780 TTGTGAAAGCAAATGTATCTAGG 0: 1
1: 0
2: 2
3: 32
4: 249
944497960_944497965 29 Left 944497960 2:200327706-200327728 CCTTTTTAATGGAAGTATTACAC 0: 1
1: 0
2: 1
3: 9
4: 217
Right 944497965 2:200327758-200327780 TTGTGAAAGCAAATGTATCTAGG 0: 1
1: 0
2: 2
3: 32
4: 249
944497963_944497965 -9 Left 944497963 2:200327744-200327766 CCTCCAAGGAGTTTTTGTGAAAG 0: 1
1: 1
2: 0
3: 14
4: 272
Right 944497965 2:200327758-200327780 TTGTGAAAGCAAATGTATCTAGG 0: 1
1: 0
2: 2
3: 32
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944497965 Original CRISPR TTGTGAAAGCAAATGTATCT AGG Intronic
904959283 1:34318704-34318726 CTGTCAAAGCCAACGTATCTGGG + Intergenic
905104334 1:35554974-35554996 TTCTGAATGCAAATGTCTTTAGG + Intronic
906493992 1:46290451-46290473 TTGTAAAAACAAATATATATAGG - Intronic
907349804 1:53818812-53818834 TTGTCAAAGAGAATGTATTTAGG - Intronic
908436359 1:64110742-64110764 TTCAGAAAGCTCATGTATCTTGG + Intronic
908441594 1:64160655-64160677 TAGTGAAAGCAAATGGATGGGGG + Intronic
909327936 1:74375857-74375879 TTGATAAATCAAATCTATCTAGG + Intronic
909928841 1:81471672-81471694 TTGTGAAGAAAAATGTATATAGG + Intronic
910087093 1:83416305-83416327 TTGAGTAAGCAATTGCATCTAGG + Intergenic
910767924 1:90801064-90801086 TTGAGAAAACAAAGGTTTCTGGG + Intergenic
910947802 1:92613150-92613172 TGGTGAAAGCCATTGCATCTTGG + Intronic
910977410 1:92921268-92921290 TTGAGAAAGCAATTGTGTTTTGG + Intronic
911452172 1:98077167-98077189 TTGTGAAAGCAATGAAATCTGGG - Intergenic
911472986 1:98341280-98341302 ATGTGCAAGGAAATGTATTTTGG + Intergenic
911575945 1:99578262-99578284 TAGTGAAGTCAAATGTATGTGGG + Intergenic
912537162 1:110383269-110383291 TTGATAAATCAACTGTATCTAGG - Intronic
913086474 1:115442115-115442137 TACTGAAATCAAATGTTTCTAGG + Intergenic
914706856 1:150177307-150177329 TTGTGAAAGAAAATGTTTGCTGG - Intergenic
917419741 1:174850326-174850348 TTATTAAAGCATATGTATTTGGG - Intronic
918881906 1:190135152-190135174 TTGTGATAACAAATGCATATGGG + Intronic
919085420 1:192915406-192915428 TTGTGGAAGCACATGTCTGTTGG + Intergenic
919617699 1:199828047-199828069 TTGTGGATACAAATATATCTTGG + Intergenic
921014579 1:211176797-211176819 TTGTGAAAGAAAATGAATCTTGG + Intergenic
922883661 1:229001730-229001752 ATGTGGAAGGAAATGGATCTTGG + Intergenic
923389385 1:233498873-233498895 TTGTGACACCAAATGTATGGGGG - Intergenic
924136216 1:240969881-240969903 CTTTTAAATCAAATGTATCTGGG + Intronic
1063833259 10:9981519-9981541 TTCTGAAAGAAAATGCATCCTGG + Intergenic
1063845283 10:10120987-10121009 TTGTATAAGCAAAAATATCTTGG + Intergenic
1063994215 10:11602262-11602284 TTGAGGAAACAAATGTAGCTTGG - Intronic
1064790109 10:18949480-18949502 TTTTGAAAGCAAATTTTTCAGGG + Intergenic
1065456653 10:25913179-25913201 TTGTAAAAGCAAATCTTCCTGGG + Intergenic
1065998473 10:31081968-31081990 TTAAGAAAGCAAATGTAACAAGG + Intergenic
1067929653 10:50547459-50547481 TTGGGAGAGTATATGTATCTAGG - Intronic
1068660455 10:59617804-59617826 TTATGTAGGCAAATGTATGTAGG - Intergenic
1069139688 10:64808132-64808154 TATTGAAAGCATATGTATTTAGG + Intergenic
1070333196 10:75432218-75432240 TTATGAAGGCAAAAGTGTCTAGG + Intronic
1071079277 10:81790806-81790828 TTGTTAAAGTAAATATTTCTGGG + Intergenic
1071447615 10:85763292-85763314 TCGTAAGAGAAAATGTATCTGGG - Intronic
1073088030 10:100907856-100907878 CTCTTAAAGCAAATGTCTCTTGG - Intergenic
1073950190 10:108799116-108799138 TTTTGAAAGCAATAGTATATTGG - Intergenic
1074090482 10:110248822-110248844 TTTTAAAAACAAATATATCTTGG - Intronic
1074179829 10:111049590-111049612 ATTTGAAAGCAAAGTTATCTTGG - Intergenic
1075625866 10:123964223-123964245 ATTAGAAAGCAAATGTATGTGGG - Intergenic
1076127772 10:127989099-127989121 TTCTGATAGCAGATGAATCTTGG - Intronic
1076172802 10:128336824-128336846 TTCTGAAATCAAATATAACTGGG - Intergenic
1077859452 11:6161981-6162003 TTGTGAAAGAAAAAATATCTTGG - Intergenic
1078436608 11:11330704-11330726 TTGACAAACCAAATGTTTCTGGG + Intronic
1078917764 11:15796059-15796081 TTGTGAAAGAAAATCTATTCAGG + Intergenic
1078986940 11:16606438-16606460 CTGTGAAAGCAAATGCGTGTCGG - Intronic
1079576720 11:22012832-22012854 TTCTGAAAGCACATATATTTTGG - Intergenic
1080042280 11:27771356-27771378 CTTTGAAATCAGATGTATCTTGG - Intergenic
1080777533 11:35400002-35400024 TTGTGATATCAAATGGCTCTGGG - Intronic
1081592712 11:44436002-44436024 TTGTTTAAGCCACTGTATCTAGG - Intergenic
1087270411 11:96105644-96105666 TTCTTATAGCAACTGTATCTAGG + Intronic
1087340077 11:96893461-96893483 TTGTGAAATTAATTATATCTTGG + Intergenic
1087803112 11:102525545-102525567 CTGTGAAAGGAAAAGTGTCTGGG - Intronic
1088715240 11:112543306-112543328 TTGTGGAAGGAAATGTATCCTGG - Intergenic
1089370805 11:117955098-117955120 TTTTGAACTCAAATGGATCTGGG + Intergenic
1089714455 11:120344389-120344411 TTGTGTTAGCAAGTGTATTTGGG - Intronic
1091638939 12:2219734-2219756 TCGTGAAAGCAAGTGTTTCCAGG - Intronic
1093091191 12:14922712-14922734 TTGTGAAAGACAATGTTTCTAGG - Intronic
1093949879 12:25152839-25152861 TTCTGACACCAAATGTATGTGGG - Intronic
1095651652 12:44617925-44617947 TTCTGAAATCAAATCTATTTTGG + Intronic
1098180546 12:67841516-67841538 TTGTAATAGCAGATGTATATAGG + Intergenic
1099200140 12:79666903-79666925 GTGTGAAAGAAAATAAATCTTGG + Intronic
1100674260 12:96848980-96849002 CAGTGAAAGCAAATATATCTAGG + Intronic
1104283967 12:127406046-127406068 TGGTGAAAGAAAATGTCTCTGGG + Intergenic
1105471486 13:20699000-20699022 TTTTTAAAGCTAATGTAGCTGGG + Intergenic
1106374059 13:29166873-29166895 TTTTTAAAGTAAATGTATTTCGG + Intronic
1106603469 13:31206992-31207014 TTGTTAAAGCAAAGGTTTTTGGG + Intronic
1108563708 13:51673018-51673040 TTGTGAAACCAAAGGTACATAGG - Intronic
1109035031 13:57246387-57246409 TTGTGAGACCAAATTTGTCTTGG - Intergenic
1109162427 13:58992108-58992130 TTTTGAAATCAAATATATGTAGG - Intergenic
1109390639 13:61687156-61687178 TTGTGACATAAAATGTATGTTGG + Intergenic
1110471282 13:75862803-75862825 CTGAGAAAACAAATGTTTCTGGG + Intergenic
1110833258 13:80055541-80055563 TTGTGAAAAGAAATGCATATGGG - Intergenic
1113025547 13:105937281-105937303 GGGTGAAATCAAATGTATCTTGG + Intergenic
1114505369 14:23208122-23208144 TTGTGAAAGGAAATAAATCTTGG - Intronic
1115862133 14:37699332-37699354 TTCTTAAAGCAACTGTATCCAGG + Intronic
1116383789 14:44305442-44305464 TTGTAACAGCAAATTAATCTTGG + Intergenic
1116906333 14:50407223-50407245 TTGTCATGGAAAATGTATCTTGG - Intronic
1117064002 14:51990295-51990317 TTGTGAATACAAAGGTATTTGGG + Intronic
1118274790 14:64376263-64376285 TTGTCAAAGCAAATGTAGACGGG - Intergenic
1119542087 14:75446295-75446317 TTGGGAAAGGAAATATATGTAGG - Intronic
1121165824 14:91797496-91797518 GTGTGAAAGGAAATAAATCTTGG - Intronic
1122346426 14:101063857-101063879 GTGTGAAAGGAAAGTTATCTCGG - Intergenic
1122360820 14:101161874-101161896 ATGTTAAAGAAAATGTATTTTGG + Intergenic
1125233619 15:37485473-37485495 TTGTGAAAGATTATGTTTCTGGG - Intergenic
1126447052 15:48758794-48758816 TTGTTAAAGCATAGCTATCTGGG - Intronic
1128289221 15:66464075-66464097 ATGTGAAAGAAAATAAATCTTGG - Intronic
1130016495 15:80190774-80190796 TTATGAAAGCAAACATATCTAGG - Intergenic
1130357423 15:83146246-83146268 TTTTGAAAGCAAAATTATGTAGG + Intronic
1133541032 16:6754380-6754402 TTGTAAAAGCAAAGTCATCTTGG + Intronic
1134228633 16:12411930-12411952 TTGTTGAATCAAATGTCTCTGGG + Intronic
1135506315 16:23039902-23039924 ATGTCAAAGCAAATATTTCTGGG - Intergenic
1135859846 16:26045994-26046016 TTTTGAAAGCAAATGTTTTATGG - Intronic
1136709195 16:32220488-32220510 TTGTGAATGGAAATGTAGCAGGG - Intergenic
1136758715 16:32708931-32708953 TTGTGAATGGAAATGTAGCAGGG + Intergenic
1136809393 16:33161448-33161470 TTGTGAATGGAAATGTAGCAGGG - Intergenic
1136815869 16:33271528-33271550 TTGTGAATGGAAATGTAGCAGGG - Intronic
1138892771 16:61165306-61165328 TGGTGAAATAAAATGTCTCTTGG + Intergenic
1140454895 16:75099303-75099325 TTGTCAAAGCAAAGATATCTGGG - Intronic
1142423695 16:89989314-89989336 CTGTGAATGCAAATATTTCTGGG - Intergenic
1203060869 16_KI270728v1_random:969262-969284 TTGTGAATGGAAATGTAGCAGGG + Intergenic
1143415528 17:6746047-6746069 TTTTTAAAAAAAATGTATCTAGG - Intergenic
1143817632 17:9530701-9530723 TTGACATAGGAAATGTATCTTGG - Intronic
1143903537 17:10192422-10192444 TGGTGAAAGAAAATGTTTTTTGG - Intronic
1144156292 17:12507214-12507236 TTAAGAAAGCAAATGTCTCTGGG + Intergenic
1147031339 17:37639793-37639815 TTGTGGCAACAAATGTATTTAGG - Intronic
1150437125 17:65162767-65162789 TTGTAAAAATAAATGTATCCCGG - Intronic
1151242543 17:72769415-72769437 TTGTGAAAGGAAACGGATCTTGG + Intronic
1153220547 18:2857031-2857053 CTGTAAAAGCAAACGTTTCTGGG + Intronic
1154076015 18:11202532-11202554 TTGTGAAAGTCTATGTTTCTAGG - Intergenic
1156935708 18:42704293-42704315 TTTTGAAAACAATTCTATCTTGG - Intergenic
1157300492 18:46475464-46475486 GTGTGCATGCAAGTGTATCTGGG - Intergenic
1158410121 18:57198240-57198262 TTTTAAAAGCACATGTATTTTGG + Intergenic
1159657828 18:71053876-71053898 TAATGAAAGCAAATGTCTCTGGG + Intergenic
1160482057 18:79250515-79250537 TTGTCACAGCAAAAGGATCTGGG + Intronic
1162081662 19:8221489-8221511 TTCTGAAAATAAATGTATTTCGG + Intronic
1162708117 19:12571196-12571218 TGGGGAAAGCAAACATATCTGGG - Intronic
1164775608 19:30851233-30851255 TTGTGAAAGAAAATCAATCCAGG - Intergenic
1168556374 19:57345355-57345377 TTGTGATAGCTAATATATTTGGG + Intergenic
925286514 2:2719724-2719746 TTGAGAAAGTTAATGTCTCTAGG - Intergenic
925558181 2:5154830-5154852 CTGTGAAAGCAAATTAAGCTAGG + Intergenic
926208380 2:10850113-10850135 TTGTGAAAGGAAAAACATCTCGG + Intronic
927016524 2:18969081-18969103 TTGTGAAGGCAACTGTGTTTTGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930926620 2:56825959-56825981 TTCTGGAAACAAATGTTTCTGGG - Intergenic
931846845 2:66212870-66212892 TTGTGAAAGAAAATGAATGTTGG + Intergenic
933516010 2:83303073-83303095 TTGTGAAAGGAAAAAAATCTTGG + Intergenic
935153346 2:100460128-100460150 ATGTGAAAGAAAATAAATCTTGG + Intergenic
937835420 2:126466349-126466371 GTGTGAAAGAAAATGCATCAAGG + Intergenic
940108736 2:150127173-150127195 TTGTGAAAGAAAATGTTTTGTGG - Intergenic
940263582 2:151812113-151812135 TTGTGAAACCAAATGTACCTAGG + Intronic
941227452 2:162866787-162866809 TTGTGGAAGGAAATATATCTTGG - Intergenic
942213874 2:173699015-173699037 ATGTGAAAGAAAATAAATCTGGG + Intergenic
942376983 2:175347740-175347762 TTGTTAAAGCCATTGTATTTGGG - Intergenic
942553261 2:177143786-177143808 TTGAAAAAGTAAATGTATCCTGG - Intergenic
944195967 2:197053231-197053253 TTGTGTACGCAAATGGATGTGGG - Intronic
944497965 2:200327758-200327780 TTGTGAAAGCAAATGTATCTAGG + Intronic
944642737 2:201744740-201744762 ATGTGAAATGAAAGGTATCTTGG - Intronic
945011500 2:205468804-205468826 TTGTTAAAGGAAATGCATGTAGG - Intronic
945227530 2:207547454-207547476 TTGTCAAAGTAACTGTATGTAGG + Intronic
946389235 2:219405421-219405443 TTGGGAAGGGAAATGTATCTGGG + Intergenic
948741524 2:240050097-240050119 TTGTGACAATAAATGTATGTAGG + Intergenic
1174536706 20:51256915-51256937 TTCTGACACCAAATGTATGTGGG + Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177251758 21:18600745-18600767 TTGGGAAAGCACATGTAATTAGG - Intergenic
1177320273 21:19512162-19512184 ATTTGAAAATAAATGTATCTGGG + Intergenic
1177649604 21:23943240-23943262 TTGTGAAAGAAAATAAGTCTTGG - Intergenic
1177764653 21:25443420-25443442 TTGGGAAAGCATATGTTTCCAGG - Intergenic
1178530922 21:33375204-33375226 GTGTGAAGGAAAATGTGTCTTGG - Intergenic
1178779900 21:35592649-35592671 CTTTGAAACCAAATGTTTCTGGG - Intronic
1182911030 22:33984820-33984842 TTCTGAAAACATATGTTTCTTGG - Intergenic
950817304 3:15719545-15719567 TAGTGAAAGCATATTTATTTGGG + Intronic
951263976 3:20546329-20546351 TAGAGACAGGAAATGTATCTAGG - Intergenic
952209167 3:31212015-31212037 ATATGAATGCAAATGTATATAGG - Intergenic
952212300 3:31240437-31240459 TTGTATTAGCAAATATATCTTGG + Intergenic
953101185 3:39829861-39829883 TTGTGAATGCAACTGTACGTAGG + Intronic
953525502 3:43687109-43687131 TTGAGAAAGCAAATGTGGCAGGG - Intronic
954657031 3:52200435-52200457 TTTTAAAAACAAATTTATCTTGG + Intronic
954723360 3:52585209-52585231 TTGTGAAATCAAGATTATCTTGG + Intronic
955453085 3:59091552-59091574 TTGTGAAAGCAAATATTGCTGGG + Intergenic
957153884 3:76521495-76521517 TTTTGAAAACAGATTTATCTGGG + Intronic
957508165 3:81153197-81153219 TTGTGAAAGGAACTGTAAATCGG + Intergenic
957595854 3:82264506-82264528 TTGTGTAAGGAAATGTAATTTGG + Intergenic
957835250 3:85579349-85579371 TTGTGAGACCAAATGGGTCTGGG - Intronic
959003612 3:100993683-100993705 TTGTGAAAGAAGAAGTATTTAGG + Intergenic
959258163 3:104041299-104041321 AAGTGAAAGCAAATGTCTCCAGG + Intergenic
959281426 3:104346779-104346801 TTGTGAAAGAAAAAATATCTTGG + Intergenic
960073278 3:113455832-113455854 TTGTTAAAGCAAATTTGTCAGGG - Intronic
960217576 3:115060757-115060779 TTTTGCAAACATATGTATCTTGG - Intronic
961627648 3:128274882-128274904 TTGTGAAAGCAAATGGCCCTTGG - Intronic
962682000 3:137810008-137810030 CTGTGAAGACAAATGGATCTTGG - Intergenic
962699939 3:137988129-137988151 TTGTGAAAGAAAATGCAGGTTGG + Intergenic
963230918 3:142908092-142908114 TTATGAGAGCCAATGCATCTTGG - Intergenic
964023401 3:152042056-152042078 TTGTAACATCAAATGTATCGGGG - Intergenic
964185499 3:153937778-153937800 TTGTGAAAAAGAATCTATCTTGG + Intergenic
965075079 3:163965229-163965251 TTTTGGAAACAAATGTATATGGG + Intergenic
965370406 3:167855240-167855262 TTGTGAATGCAAAGGTAGATGGG + Intergenic
966176766 3:177146910-177146932 TTGTGAATGCAAAAGTATGATGG - Intronic
966191608 3:177276887-177276909 TTTTTAAAGCCAATGTATTTTGG - Intergenic
967293157 3:187941317-187941339 CTGTGAAAGCAAGTTCATCTAGG + Intergenic
968124327 3:196147223-196147245 TAGGGAAAGTAAATGGATCTAGG + Intergenic
970790043 4:19846562-19846584 TTGTTTAAAGAAATGTATCTAGG + Intergenic
973319170 4:48792849-48792871 TTGTGAGAGAGAAAGTATCTGGG + Intergenic
973915284 4:55627683-55627705 TAGTGAAAAGAAATGTATATTGG + Intronic
974358137 4:60838846-60838868 TTGTGACAGAAAATGTATGTGGG - Intergenic
979675632 4:123407491-123407513 TTGTGAAAGGAACAGTAACTTGG + Intergenic
979864358 4:125734953-125734975 TTGTTAAATCAAATGTTTCAGGG + Intergenic
980058481 4:128102697-128102719 TTGTTAGAGCAAATTGATCTTGG + Intronic
980200412 4:129649989-129650011 TTGTAAAAGAAAATGTACATAGG - Intergenic
980877134 4:138672894-138672916 TTGGGAACACAAATGTCTCTTGG - Intergenic
981250224 4:142592269-142592291 TTCTAAAAGCAATTGTATATTGG - Intronic
981316864 4:143349135-143349157 CTATGAAGGCAAATGTACCTGGG - Intronic
981677239 4:147356496-147356518 TTGAGAAGGCAAATGAATGTAGG + Intergenic
987495287 5:18635409-18635431 TTCTGATAGTAAATGTTTCTAGG + Intergenic
988017186 5:25574195-25574217 TTGTGAAGATAAATCTATCTAGG + Intergenic
988242092 5:28626446-28626468 TTGTGAATGCAAAGATGTCTTGG - Intergenic
989374968 5:40751535-40751557 TTGTGAGGGCTAATGTAGCTGGG - Intronic
989566353 5:42905027-42905049 ATGTGAAAGCAAGTGTATTAAGG - Intergenic
990800189 5:59593391-59593413 CAGTGAAAGCAAATCTATTTTGG - Intronic
994066705 5:95551736-95551758 TTAGGAAATCAAATGGATCTAGG + Intronic
997085772 5:130796718-130796740 TTATTAAATAAAATGTATCTGGG + Intergenic
997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG + Intergenic
997334730 5:133098962-133098984 ATGTAAAAGCAAGTGCATCTGGG - Intronic
999652406 5:153780280-153780302 TTTGGAAAGCAAATGTGTTTTGG + Intronic
1000241739 5:159415026-159415048 TTTTGAATGCAAATGTGCCTAGG - Intergenic
1000780818 5:165478568-165478590 ATGTGAAAGCAATCCTATCTTGG + Intergenic
1001672964 5:173489946-173489968 CTTTGAAATCAAATGTGTCTGGG - Intergenic
1003648064 6:7932138-7932160 TTGTGAAAACAAATGTAAATGGG - Intronic
1003989175 6:11468984-11469006 TTGTTAAAGCACCTGTTTCTGGG + Intergenic
1004046114 6:12025373-12025395 TTGTGATAGCAAATCTAACTTGG - Intronic
1004593570 6:17077173-17077195 TTGGGAAAGCATATGTGTCCAGG - Intergenic
1005150053 6:22738514-22738536 ATGTTAATGCAAATGTGTCTAGG - Intergenic
1005633272 6:27729152-27729174 TTGTGAAGGGAAATGAAGCTTGG - Intergenic
1008050833 6:46899063-46899085 TTGTGAATGGAAATGTATCAAGG + Intronic
1008414304 6:51221718-51221740 TTTACAAAACAAATGTATCTTGG + Intergenic
1008475824 6:51934723-51934745 TAGTAAAAGGAAATGTAACTAGG + Intronic
1009051636 6:58283173-58283195 CTGTGAAAGCAGATGTAAATGGG + Intergenic
1010242430 6:73628651-73628673 TTTTGAAAGCAAATATACTTTGG + Intronic
1010523097 6:76865633-76865655 TAGTTAATGCAAATGTGTCTAGG - Intergenic
1011120846 6:83950969-83950991 TTGTGATAATAAATGTTTCTGGG - Intronic
1011865247 6:91817642-91817664 TTATGAAAGCATATTTATTTGGG + Intergenic
1014315030 6:119853085-119853107 TTCTGAAAGCAAGTTTATCTAGG - Intergenic
1014677732 6:124388367-124388389 TTGTTAAAACAAATGTTTCTGGG + Intronic
1015856467 6:137630203-137630225 TTACAAAAGCAAATGTATCCAGG + Intergenic
1016494642 6:144646687-144646709 CTGGGAAAGCAAATGTATCAGGG + Intronic
1017368232 6:153670295-153670317 TTGTGAAGGAAAATAAATCTTGG - Intergenic
1018586402 6:165364669-165364691 TTGTTAAAGCAACTTTATTTAGG - Intronic
1022082222 7:27034072-27034094 TAGTGCAAGCAAATGGATGTGGG - Intergenic
1024391974 7:48825136-48825158 TATTGAAAGCTAATGTGTCTGGG + Intergenic
1024476012 7:49812096-49812118 TTGTGAAGGCAAATTTATATAGG + Intronic
1028214069 7:88110304-88110326 TTGTGACAGCAAGTGTATATTGG + Intronic
1028659894 7:93258581-93258603 TTAGAAAAGCAAATGTATTTGGG + Intronic
1029066822 7:97858007-97858029 TTTTGAAAGTAAAGGTGTCTGGG - Intronic
1030814047 7:114012355-114012377 TTGTGAACCCAAATGTGCCTGGG - Intronic
1032344234 7:131105366-131105388 TTGTGAAATCACATCTATTTAGG - Intergenic
1032806138 7:135356256-135356278 TTGGGAAAGAACATGCATCTTGG - Intergenic
1037154768 8:15685918-15685940 TTGTGAAATCAAACATGTCTAGG + Intronic
1038078688 8:24107204-24107226 TTGTGAAAGCAATAGTATAATGG + Intergenic
1040122768 8:43700990-43701012 TTTTAAAAGCAAATGTCTCCTGG + Intergenic
1041544316 8:59024829-59024851 TTTTAAAAGAAAATGAATCTTGG - Intronic
1041828029 8:62120164-62120186 CTATGAAAGAAAATGTAGCTTGG - Intergenic
1042632701 8:70837401-70837423 ATGTGACAGCAAATGTTTATAGG - Intergenic
1044553278 8:93535505-93535527 TTGTGAAAACAAGTGTGTGTGGG - Intergenic
1045751830 8:105494434-105494456 TTATGAAAGCAAAAGCACCTAGG - Intronic
1046461345 8:114541504-114541526 GTGAGAAAGTAAATGTGTCTTGG - Intergenic
1049133109 8:140867041-140867063 TTGGGAAGGCAAGTGTAGCTGGG + Intronic
1049909235 9:249417-249439 TTTTGAAAGAAAATGTATTGAGG - Intronic
1050814147 9:9788210-9788232 TTGTGAAAGAAAATTTGACTAGG - Intronic
1051370315 9:16353839-16353861 TGGTGAAAGCAAATATGTTTGGG - Intergenic
1051633109 9:19158179-19158201 TTGTGAAAGCATATTTCTGTAGG - Intergenic
1052018670 9:23499542-23499564 TTTTTTAAGCAAATGTAACTGGG + Intergenic
1052042998 9:23761733-23761755 TTCTAAAAGTATATGTATCTGGG - Intronic
1052143471 9:25019407-25019429 TAGTAAAAGCAAATGTAAATTGG - Intergenic
1052374028 9:27697646-27697668 TTGTCAAAGTACATGGATCTTGG - Intergenic
1053569721 9:39291630-39291652 TTGTGAAAGTAGATCTATTTAGG - Intergenic
1053835682 9:42132662-42132684 TTGTGAAAGTAGATCTATTTAGG - Intergenic
1054091352 9:60850635-60850657 TTGTGAAAGTAGATCTATTTAGG - Intergenic
1054112767 9:61126205-61126227 TTGTGAAAGTAGATCTATTTAGG - Intergenic
1054127427 9:61327383-61327405 TTGTGAAAGTAGATCTATTTAGG + Intergenic
1054594947 9:67055943-67055965 TTGTGAAAGTAGATCTATTTAGG + Intergenic
1056058166 9:82851367-82851389 TTGTGAAAGAAAACAAATCTTGG + Intergenic
1057969289 9:99538245-99538267 TTCTTGAAGCAAATGTATATGGG - Intergenic
1059610055 9:115882967-115882989 TTGCTAAGGCAAATGTAACTTGG - Intergenic
1186682793 X:11893502-11893524 TTAGGAATGAAAATGTATCTTGG + Intergenic
1187308938 X:18122386-18122408 TCCTGAATGCAAATGTATCATGG - Intergenic
1189092127 X:38094723-38094745 CTGTTATAGCAAATGTATCCTGG - Intronic
1189740992 X:44117049-44117071 TTGTGAAAACACAGGTTTCTAGG + Intergenic
1189744425 X:44155420-44155442 ATGTCAAAGCAAATAAATCTAGG - Intronic
1190254422 X:48751977-48751999 TAGTGAAACCAAAGCTATCTTGG + Intergenic
1193179685 X:78440138-78440160 TTGTGAACCCAAAAGTATCTGGG - Intergenic
1194464279 X:94213073-94213095 TTGTGAAAGCTACTGTATTTGGG + Intergenic
1195392507 X:104377275-104377297 TTCTGAAAGCAACTGAACCTTGG - Intergenic
1196291508 X:113947151-113947173 ATGTGAAAGAAAATGTAACCAGG + Intergenic
1196539324 X:116886251-116886273 TTGTCTAAGCAAGTGTGTCTTGG - Intergenic
1196608312 X:117681346-117681368 ATGTGATAGCACATCTATCTGGG + Intergenic
1196773264 X:119316836-119316858 ATGTGAAAGGAAATAAATCTTGG + Intergenic
1198128438 X:133670504-133670526 TTGTGAAATCAAATTTTTTTTGG - Intronic
1198845412 X:140905326-140905348 TGATGAAAGCAAATGTATTGGGG + Intergenic
1199490184 X:148388803-148388825 TTGTTGAAGCAAATGTATTTTGG - Intergenic
1199905935 X:152229731-152229753 TAGTGAAAGCAAAAATATCCAGG - Intronic
1202051506 Y:20785648-20785670 TTTTGAAAGCAAATGAAACTGGG + Intergenic