ID: 944498202

View in Genome Browser
Species Human (GRCh38)
Location 2:200329722-200329744
Sequence AAAGATCCACAGACGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944498202 Original CRISPR AAAGATCCACAGACGTGGCA AGG (reversed) Intronic
901879187 1:12184328-12184350 AAAAATCCACAGCCTTGTCATGG - Intronic
905197103 1:36288414-36288436 AGAGATTCACAGTCCTGGCATGG - Intronic
906622280 1:47292158-47292180 AAAGGTCCCCAGACCAGGCATGG - Intronic
912306392 1:108571893-108571915 AAAGATACAGAGAAATGGCAAGG - Intronic
915833299 1:159151663-159151685 AAAAATCCATAGAAGTGGCCGGG + Intergenic
917068679 1:171125448-171125470 AAACATCCTCAGACTTGGGATGG + Intergenic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917448446 1:175126629-175126651 ATAGATCCTCAGAGATGGCAGGG - Intronic
918450524 1:184653333-184653355 AAGGATTCACAGAGGTGTCATGG - Intergenic
921510917 1:216028090-216028112 AAAGATTCACAGAAGTGGCCGGG + Intronic
921577511 1:216854061-216854083 AAAGCTCCCTAGATGTGGCAGGG + Intronic
922066954 1:222153499-222153521 AAAGAGGCACAGACCTGGGATGG + Intergenic
923737648 1:236626333-236626355 AAACAACCACAGTCGGGGCAAGG - Intergenic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
1067115464 10:43432468-43432490 AAAGAACCACAGATGTAGCCAGG - Intergenic
1067436135 10:46280082-46280104 AAAGATACAGAGATGTGGCCGGG - Intergenic
1069487435 10:68833063-68833085 AAAAACCCACAGAAGTGGCTAGG - Intronic
1070574719 10:77669120-77669142 ACAAATCCACAGTCGTGTCAGGG - Intergenic
1077824791 11:5794613-5794635 AAAGTTAGCCAGACGTGGCAAGG - Intronic
1079883251 11:25952901-25952923 GAAGATCCAGAGAATTGGCAGGG - Intergenic
1080394758 11:31879813-31879835 AAAGAGCCACAAACATGGCATGG - Intronic
1081724746 11:45320529-45320551 AAAGAACCACAGAGCTGGCAAGG + Intergenic
1085023987 11:73226010-73226032 AAAGGTGGACAGACGGGGCAGGG + Intronic
1086782778 11:90928915-90928937 AAAGAACGAAAGAGGTGGCAGGG - Intergenic
1090336734 11:125973570-125973592 AACCATCCACAGATGTGCCATGG + Intronic
1092498989 12:9027479-9027501 AGAGAGCCAGAGAAGTGGCAGGG - Intergenic
1092502889 12:9065305-9065327 AAATGTCCACAGCCGCGGCAAGG - Intergenic
1093327238 12:17792344-17792366 AAAGATTAGCAGACGTGACAAGG + Intergenic
1093552545 12:20432135-20432157 AAAGTCACACAGAAGTGGCATGG + Intronic
1094430275 12:30360625-30360647 AAAAATTCACAGATCTGGCAGGG - Intergenic
1095996292 12:48088343-48088365 AAAGAGTCACAGACCGGGCACGG - Intronic
1096866524 12:54567158-54567180 AAAGATAGACACATGTGGCATGG + Intronic
1102663063 12:114546456-114546478 AGAGATCCACAGATCTGGAAAGG - Intergenic
1104682933 12:130763693-130763715 AGAGATGCACAGACGAGGTACGG - Intergenic
1105458553 13:20563262-20563284 AAAGATCCTCAGGCCTGGTATGG - Intergenic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1107690783 13:42950859-42950881 AAAAATCCAAAGAGGTGGCTGGG + Intronic
1112664553 13:101554564-101554586 AATGTTCCACAGACGCAGCATGG - Intronic
1116867065 14:50039812-50039834 GAAGATCCATAGCCATGGCAGGG - Intergenic
1118812787 14:69287567-69287589 AAACATCCAGAGACGTGTAAGGG - Intronic
1118912034 14:70069622-70069644 AAAGAGCCAGAAACCTGGCAGGG - Intronic
1118968485 14:70610833-70610855 AAAGAGTCACAGAAGTGGGAGGG + Intergenic
1122920418 14:104877683-104877705 CAAGTTCCACAGCCATGGCAGGG - Intronic
1123188210 14:106540323-106540345 AAAGATCCACAGACCCTGTAGGG + Intergenic
1128742087 15:70090715-70090737 AAAGATTCACAGACCGGGAAAGG - Intronic
1130303014 15:82694393-82694415 AAAGAACCACAGGCCAGGCATGG + Intronic
1131461212 15:92618867-92618889 AAGGAGCCACAGACGTGTCCAGG + Exonic
1137671003 16:50279160-50279182 AGAGCTCCATAGACCTGGCACGG - Intronic
1138662687 16:58533339-58533361 TAAGAACCACTGACGTGGCCGGG + Intronic
1139745263 16:69069010-69069032 AAAGATCCAAAAACATGGCTGGG - Intronic
1140520697 16:75578652-75578674 AAAGATGCACAGAAGTGATATGG - Intergenic
1141484663 16:84330673-84330695 AGAGATGCACAGACGTTGCCAGG - Intergenic
1141932066 16:87212137-87212159 AAACATCCACAGTCGTGGGTGGG - Intronic
1143811226 17:9473312-9473334 AAAGATCCTGAGACATGGCTGGG - Intronic
1144940456 17:18935869-18935891 AAAGATATACAGGCTTGGCATGG + Intergenic
1146696275 17:34911059-34911081 AAAATTCCCCAGACGTGCCAGGG + Intergenic
1148282546 17:46360379-46360401 AAAGATCTTCAGACCAGGCAGGG + Intronic
1148304764 17:46578304-46578326 AAAGATCTTCAGACCAGGCAGGG + Intronic
1148709779 17:49669975-49669997 AAAGAACTACTGACATGGCAAGG + Intronic
1150530363 17:65974826-65974848 ATATATCCACAGAAGTGGCTTGG + Intronic
1150874707 17:68957342-68957364 AAAAATCCCCAGACATGTCAAGG + Intergenic
1152831744 17:82501516-82501538 AAAGATGCACAGGCCGGGCACGG + Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155428019 18:25726333-25726355 TAAGATGCTCAGATGTGGCAAGG + Intergenic
1155584722 18:27351873-27351895 AAAAATCCTCAGACTGGGCATGG + Intergenic
1155634864 18:27940497-27940519 AAAGCTCCAAAGAGTTGGCAAGG - Intergenic
1157290754 18:46407935-46407957 AAAGATCCAGAGAGGTGGTCAGG + Intronic
1157578116 18:48757527-48757549 GAAGATTCACACACGTGGAACGG + Intronic
1158692811 18:59676354-59676376 AAAGAGCCATAGACTTGCCATGG - Intronic
1160595394 18:79970082-79970104 ACAGTGCCACAGACGAGGCAAGG + Intronic
1160700846 19:506650-506672 GAAGATCCACAGAGGTCGCCTGG + Intergenic
1161626827 19:5331934-5331956 AAAGAACCGCAGAGGTGGCTGGG + Intronic
1166723179 19:45009374-45009396 AAAGATACAAAGAGGTGGCCAGG - Intronic
1166801250 19:45458662-45458684 AAAGACCCACTGACTTGGCCGGG - Intronic
1167206826 19:48108156-48108178 AAAGACCCACAGACCCTGCAGGG + Intronic
1167514601 19:49915802-49915824 ACACATCCACAGTCCTGGCAGGG - Intronic
1167824515 19:51960256-51960278 AAATATCCACAGGGGTGGAAGGG - Intergenic
1168415090 19:56162665-56162687 TGAGATCCACAGATGTGGCCCGG - Intergenic
925185384 2:1843141-1843163 AACGAGCCACAGACAAGGCAGGG - Intronic
926158343 2:10470504-10470526 ACAGAGCCCCACACGTGGCAAGG - Intergenic
927020374 2:19010514-19010536 AAAGATCCACAAACTTACCAGGG + Intergenic
944498202 2:200329722-200329744 AAAGATCCACAGACGTGGCAAGG - Intronic
944606218 2:201353891-201353913 AAATATCCACTGACATGGCTGGG - Intronic
946685087 2:222260163-222260185 AAAGATAAACAGACCAGGCATGG - Intronic
1173837212 20:46133851-46133873 AAAAATCCACAAAAGTGGCCGGG + Intergenic
1174914787 20:54643351-54643373 AAAGAACCACAGAGCTGGCCAGG - Intronic
1175213940 20:57380163-57380185 AAACATCCACAAAAGTGGAAAGG + Intergenic
1175776576 20:61657631-61657653 AAAGATCTACAGAAGTTGGATGG + Intronic
1177720520 21:24901140-24901162 AAAGATCCACACACCTAGCCAGG - Intergenic
1181521956 22:23453566-23453588 AGAGACCCACAGACGTGTCCAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954791976 3:53140006-53140028 AGAAAGCCACAGAGGTGGCAGGG - Intergenic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
958984624 3:100766217-100766239 AAGCAACCACAGGCGTGGCATGG - Intronic
969065034 4:4472517-4472539 AAAGTTCCGCAGACCTTGCAAGG - Intronic
969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG + Intergenic
975321210 4:73011674-73011696 ATGGATCCACAGCCTTGGCAGGG - Intergenic
979268468 4:118731761-118731783 AAAGATGCACAAAAGTGGGATGG + Intronic
981755923 4:148141879-148141901 AATTTTCCACAGACCTGGCAGGG - Intronic
983225731 4:165084610-165084632 GAAGAACCACAGACATGGCCAGG + Intronic
985775443 5:1839104-1839126 TAAGATCCAAACAAGTGGCAGGG - Intergenic
987753209 5:22067707-22067729 AGACATCCACAGAGGAGGCAAGG - Intronic
994058142 5:95443235-95443257 GAAGATCTACAGACATAGCAGGG - Intronic
995997520 5:118319719-118319741 AAAGATCCACAGAAGTGGCCAGG + Intergenic
999764501 5:154728888-154728910 CCAGATCCACTGACCTGGCAGGG - Intronic
999977489 5:156926197-156926219 AAAAATCCACAGTAGTGGCCAGG - Intronic
1000209858 5:159099087-159099109 AAACAGTCACAGACGAGGCAGGG + Intronic
1001023458 5:168203865-168203887 AAGGTTCCAGAGAAGTGGCAAGG - Intronic
1001634154 5:173197781-173197803 AAAGAACCGCAGAGGTGGCCAGG + Intergenic
1002477672 5:179477736-179477758 ATAGATTCACAGAAGTTGCAAGG + Intergenic
1006763645 6:36485785-36485807 AAAGATCCACATAGGGGGCCAGG - Intronic
1010066146 6:71684677-71684699 GAAGATCCAGAGACTTGGAAAGG + Intergenic
1011849683 6:91610849-91610871 AAGGCACCACAGAAGTGGCAGGG + Intergenic
1027546678 7:79536001-79536023 TAAGATCCATAGAGGTGGCCGGG + Intergenic
1032459280 7:132097733-132097755 ACAGCTACACAGACGTGTCAGGG - Intergenic
1032743076 7:134759034-134759056 AAAGATCCACAGACTCTCCAAGG - Intronic
1033382350 7:140834675-140834697 AAAATCCCACAGATGTGGCACGG - Exonic
1034954591 7:155326789-155326811 AAACATCTGGAGACGTGGCAGGG + Intergenic
1037443665 8:18943142-18943164 AAAGATCAACAAAGGAGGCATGG + Intronic
1038240392 8:25802849-25802871 AAACAGCCAAAGACGTGCCATGG + Intergenic
1038505529 8:28081470-28081492 AAAGACTAACAGACGTGGCCTGG - Intronic
1042117024 8:65443397-65443419 AAAGATCCAATGACTTGGCTGGG + Intergenic
1042385170 8:68165777-68165799 AAAGATCCCCAGTTTTGGCAAGG + Intronic
1047079807 8:121446990-121447012 AAAAATCCAGTGACTTGGCATGG + Intergenic
1048421146 8:134279499-134279521 AAAGTTCCAAAGAGGTGACATGG + Intergenic
1049316141 8:141969378-141969400 AATGCTTCAGAGACGTGGCAAGG - Intergenic
1049458622 8:142709473-142709495 AAACAGCCACAGGTGTGGCAGGG - Intergenic
1049933816 9:481664-481686 AAAGAGCCACAGAATAGGCAAGG + Intronic
1053417461 9:37955781-37955803 AAAAATCCACAGACTGGGCCGGG - Intronic
1056534423 9:87515727-87515749 ACAGATCCACAGAGTTGGAAGGG - Intronic
1056826993 9:89883462-89883484 AAACACCCACAGATGTGGGAAGG + Intergenic
1058509748 9:105704628-105704650 AAATAACCACAGAAGTGGCCGGG + Intronic
1060990397 9:127845642-127845664 CATGATCCACAGAGGTGGCTGGG + Intronic
1187130263 X:16495671-16495693 CAAGATCCAAAGACCTGGCTAGG - Intergenic
1187325640 X:18284743-18284765 AAAAAACAACAGACGTGGCCGGG + Intronic
1188598800 X:31935075-31935097 AAAGCTACACAGACCTGGGAAGG + Intronic
1190051862 X:47156606-47156628 CAAGATCCAGAGGGGTGGCATGG - Intronic
1192213578 X:69142857-69142879 ACATATACACAGACGTGGGAGGG - Intergenic
1193540326 X:82763492-82763514 AAACATCCACAGACATGCAAAGG + Intergenic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1201499709 Y:14628405-14628427 AAATATAAACAGACGTGACATGG + Intronic
1201889191 Y:18922837-18922859 AAATATCCAAAGGGGTGGCAGGG - Intergenic
1201924790 Y:19272745-19272767 ATAGTTCCACAGAGGTGGTAAGG + Intergenic
1202258262 Y:22942654-22942676 AAAAACCCACGGAGGTGGCATGG + Intergenic
1202411252 Y:24576412-24576434 AAAAACCCACGGAGGTGGCATGG + Intergenic
1202459529 Y:25093660-25093682 AAAAACCCACGGAGGTGGCATGG - Intergenic