ID: 944500347

View in Genome Browser
Species Human (GRCh38)
Location 2:200352987-200353009
Sequence CAGCATCTACATGTTGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944500343_944500347 22 Left 944500343 2:200352942-200352964 CCACATTCCAATTTTAGCTGCCC 0: 1
1: 0
2: 2
3: 6
4: 135
Right 944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG 0: 1
1: 0
2: 0
3: 16
4: 169
944500345_944500347 2 Left 944500345 2:200352962-200352984 CCCAAAGTCTGAACTACTCTGAC 0: 1
1: 0
2: 1
3: 16
4: 147
Right 944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG 0: 1
1: 0
2: 0
3: 16
4: 169
944500344_944500347 15 Left 944500344 2:200352949-200352971 CCAATTTTAGCTGCCCAAAGTCT 0: 1
1: 0
2: 2
3: 40
4: 677
Right 944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG 0: 1
1: 0
2: 0
3: 16
4: 169
944500346_944500347 1 Left 944500346 2:200352963-200352985 CCAAAGTCTGAACTACTCTGACA 0: 1
1: 0
2: 1
3: 7
4: 190
Right 944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG 0: 1
1: 0
2: 0
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944500347 Original CRISPR CAGCATCTACATGTTGTACA TGG Intronic
903514576 1:23901980-23902002 CACCATCTTCCTGTGGTACACGG - Intronic
908561878 1:65314316-65314338 CAGCATCCACATTTTGAACCAGG + Intronic
909911982 1:81271821-81271843 AGGCATATACATGTTGTACTGGG + Intergenic
909984797 1:82147577-82147599 AATCATCTACATGTTCAACATGG + Intergenic
910123509 1:83815936-83815958 CAGCATCTACTTTTTCTAGATGG - Intergenic
912415141 1:109503146-109503168 CAGTATTTTCATGTTGTAAATGG - Intergenic
912486299 1:110031589-110031611 CAGCAACTCCATCTTGAACAGGG - Intronic
913689872 1:121268978-121269000 CAGCATTTAGATGTTGGAAAAGG + Intronic
914147728 1:145011294-145011316 CAGCATTTAGATGTTGGAAAAGG - Intronic
918040298 1:180910200-180910222 CAGCATCTGCCTGTTCAACATGG - Intergenic
918820602 1:189249917-189249939 CATCATCAACATGTTGTCCATGG - Intergenic
919060496 1:192626089-192626111 CAGCATGCAAATGTTGTACCTGG + Intergenic
920321058 1:205122924-205122946 CAGCATTTTCATGTTGCCCAGGG + Intergenic
920477195 1:206287455-206287477 CAGCATTTAGATGTTGGAAAAGG + Intronic
920611430 1:207441968-207441990 CAGCATTCACATATTGTAGAAGG - Intergenic
921089270 1:211828152-211828174 CAGCATCTGCATGATCTTCAAGG + Intronic
921318599 1:213915848-213915870 CATCATCTACATTTGATACATGG - Intergenic
921823003 1:219639255-219639277 GAGCCTCTTCAGGTTGTACATGG + Intergenic
923921994 1:238577125-238577147 CAGCATATAGATCCTGTACATGG - Intergenic
1063351622 10:5362088-5362110 CAGCATGAGCATGTTGTTCAGGG - Intergenic
1064839738 10:19577892-19577914 CAGCATCCAAATGTTTTACCAGG + Intronic
1067303971 10:45041617-45041639 GATCATCTACATATTGTATAAGG + Intergenic
1067664101 10:48258495-48258517 CAGCATCTCCGTTTTGTAGATGG - Intronic
1068245825 10:54365836-54365858 CTCTATCTACATGTTGAACACGG - Intronic
1069182304 10:65376788-65376810 CTGCATCTACTTGTTTTTCAGGG + Intergenic
1069561805 10:69435966-69435988 CACCATCTACATGTCATCCATGG + Intergenic
1069976233 10:72215708-72215730 CAGCATCTACCTGTCCTACATGG + Intronic
1070366197 10:75739389-75739411 CAGCATATGAATTTTGTACATGG - Intronic
1071077999 10:81777419-81777441 GTTCATTTACATGTTGTACATGG - Intergenic
1073222524 10:101887623-101887645 CAGCTTCACCATGTGGTACAGGG + Intronic
1074796768 10:116954162-116954184 AAGAATCAGCATGTTGTACATGG - Exonic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077865813 11:6220602-6220624 AAGCATCTACATGTTTAACACGG + Intronic
1083570164 11:63756235-63756257 TGGCATCTGCATTTTGTACAAGG - Intronic
1084334009 11:68446473-68446495 GAACATGTCCATGTTGTACAGGG - Exonic
1091790106 12:3267276-3267298 CAGAATATAAATGCTGTACAAGG - Intronic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1092503877 12:9074892-9074914 AAGCATCTACATACAGTACAGGG - Intronic
1093183070 12:15988771-15988793 CACCATCATCATGTTGTCCACGG + Intronic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1098626105 12:72671560-72671582 AATCATCTACATTTTGAACATGG + Intergenic
1101206667 12:102495323-102495345 AAGCATCTACATGTTGTCCTAGG + Intergenic
1104610885 12:130226893-130226915 TAGCATCTTCATGTTGTACTTGG - Intergenic
1108121911 13:47197160-47197182 TGGCAACTACATGTTATACAGGG + Intergenic
1109163981 13:59010535-59010557 TAGCATCTCCATGTTCTGCAGGG - Intergenic
1109808137 13:67470934-67470956 CAGCATCTGCATGTACCACAGGG - Intergenic
1111841060 13:93451562-93451584 GTTCATGTACATGTTGTACATGG + Intronic
1112521555 13:100100133-100100155 CATCACCTACATTTTGTAGATGG + Intronic
1113582716 13:111440232-111440254 CAGCATATCCATGTTCTCCAAGG - Intergenic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1115374488 14:32659176-32659198 CAGCAGCTTCATGTTTTACTTGG - Intronic
1115576529 14:34716904-34716926 CAGCCTCTAGATGTTGGAAAAGG - Intergenic
1116049529 14:39786065-39786087 CTGCATCTTCATGTTGAATAGGG + Intergenic
1116095854 14:40366148-40366170 CATTCTTTACATGTTGTACATGG + Intergenic
1117516100 14:56503086-56503108 CACCATATTCATGTTGTAAACGG - Intronic
1122993542 14:105250141-105250163 CAGCATCTTCCTGTGGTACACGG + Exonic
1124010852 15:25837569-25837591 CAGCATCAACATCTACTACATGG - Intronic
1127764555 15:62172402-62172424 CAGCAACTAAATCTTGTTCATGG + Intergenic
1128668583 15:69557284-69557306 CAGCATTTCCATTTTGCACAGGG - Intergenic
1130352215 15:83102574-83102596 CAGCTTCTACTTGTTCTTCAAGG + Intergenic
1132306306 15:100816091-100816113 CTGAATCCACATGTTGTGCATGG + Intergenic
1134088578 16:11375931-11375953 CAGCCTCAACATGTTCTCCATGG - Intronic
1136030533 16:27499513-27499535 CAGCAGCTTCATGCTGAACATGG + Intronic
1137343866 16:47636772-47636794 CATCATCAACATGCTGTCCATGG - Intronic
1141454510 16:84131285-84131307 CAGTTTCTACCTCTTGTACAGGG - Exonic
1144389949 17:14784296-14784318 CACCATCAACATGTTGTCCATGG - Intergenic
1145047703 17:19631345-19631367 GAGCATCTACATGCTGAACTGGG + Intergenic
1149213180 17:54326696-54326718 CAGCAACTCCATCTTGAACAGGG - Intergenic
1152016613 17:77755192-77755214 CTGCCTCTACAGGTTGAACAGGG - Intergenic
1153473054 18:5468243-5468265 CACCATCTACATGTCATCCAGGG - Intronic
1159066995 18:63581169-63581191 CTGCATCCAGATGTTGTGCATGG + Intergenic
1159322929 18:66877001-66877023 CAGCATCTAGAAGTTGGAAAAGG + Intergenic
1159704902 18:71674787-71674809 CACCATCAACATGCTGTCCACGG + Intergenic
1163186046 19:15640467-15640489 CAGCATCCAGAAGTGGTACACGG + Intronic
1165104499 19:33460974-33460996 CAGAGTCCACATGTTGTACTTGG - Intronic
1166256601 19:41610522-41610544 CAGCAGCTCCATGTTGTAGTAGG - Intronic
925632714 2:5911991-5912013 AAGCATCTGAGTGTTGTACAAGG + Intergenic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
929469057 2:42172731-42172753 CAGTATATACATTTTGCACATGG - Intronic
929982516 2:46695118-46695140 CAGTACTTATATGTTGTACAAGG - Intergenic
932949071 2:76271698-76271720 CAGCCTCTACATGATGAAGATGG - Intergenic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
936018398 2:108976561-108976583 CAGCATCTACATGAATTACCTGG + Intronic
937725627 2:125162080-125162102 TAGTAGTTACATGTTGTACAAGG + Intergenic
938748941 2:134310232-134310254 CATCATCTTCATGTTCTGCATGG - Intronic
941193992 2:162423447-162423469 CAGCATCTGCATGTGGTACCTGG + Exonic
941784121 2:169479543-169479565 CAGCACCGACATGGTGAACAAGG - Exonic
943164666 2:184305480-184305502 CAGTGTTTACATGTAGTACAGGG - Intergenic
944311546 2:198239100-198239122 ATGCATTTACATGTTGTCCATGG + Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
946517897 2:220433141-220433163 TCGCATCTACATTTTGTACAAGG + Intergenic
947480920 2:230499255-230499277 AATCATCTGCAAGTTGTACAGGG - Intronic
947512599 2:230771493-230771515 CAGGAGATACATGTTGTTCATGG + Intronic
947740982 2:232484828-232484850 CAGCGTCACCTTGTTGTACATGG + Exonic
948241063 2:236435401-236435423 CATCATTTACATGTTGTCTATGG + Intronic
948325236 2:237113273-237113295 CAGGATTTACATTTTGGACATGG - Intergenic
1170575978 20:17661747-17661769 CAGCATCTAGAGGTTTTGCAGGG - Intronic
1170920152 20:20670491-20670513 CGGAATCTACATGTTTTACATGG - Intronic
1171751962 20:29060316-29060338 CAGCATCTAAATGTTGGAAAAGG + Intergenic
1172609466 20:36239256-36239278 CAGCATCTAAAGTTTGTTCAGGG - Intronic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1175992674 20:62797209-62797231 CAGCGCCTGCATGTCGTACATGG - Exonic
1176890864 21:14317332-14317354 CAGCATCTATGTATTTTACAAGG - Intergenic
1180391073 22:12282677-12282699 CAGCATCTAAAAGTTGGAAAAGG - Intergenic
1180408668 22:12582076-12582098 CAGCATCTAAAAGTTGGAAAAGG + Intergenic
1183219939 22:36506164-36506186 CAGCATCAACAAGCGGTACACGG - Exonic
1184327694 22:43802708-43802730 TGGCATCTCCATGTTGTGCAGGG - Intronic
1185324517 22:50219190-50219212 CAGCATCTCCTTGGTGAACAAGG - Exonic
1185327436 22:50233924-50233946 CAGCATCTACACCCTGTCCATGG + Intronic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
950469692 3:13176942-13176964 CAGTATGTACCTGTTGTACCTGG - Intergenic
951767645 3:26217306-26217328 ATGCATCTACATTTTGTAAAAGG + Intergenic
951865684 3:27304747-27304769 CAGCTTCTTCATATTTTACAAGG - Exonic
951931930 3:27977329-27977351 CAGCATCAACAAGTTATACCAGG + Intergenic
965422562 3:168480308-168480330 CAGCCTCTAGAAGATGTACAAGG - Intergenic
974148696 4:57978049-57978071 ATGCATCTACATATTGTATATGG + Intergenic
974607672 4:64173977-64173999 CACCATCTACATGCAGTCCAAGG - Intergenic
974679660 4:65145318-65145340 CAAAATCTACATGTTCTAGAGGG + Intergenic
975657895 4:76659937-76659959 CAGCATATGCATGTTTTAGATGG - Intronic
977570639 4:98626045-98626067 CAACATCAACATGTTGTTCAAGG + Intronic
980164533 4:129209459-129209481 GAGCATGTACATGTCGTACCAGG - Intergenic
980598240 4:134984728-134984750 CAGCATATACATTTTGGGCAGGG - Intergenic
982673728 4:158351479-158351501 CAGCAACTACATTTTGAATAGGG - Intronic
983199798 4:164848871-164848893 CATCATCTCCATGTTTCACATGG - Intergenic
985135754 4:186784183-186784205 CAGAATCTAGATTTTGTTCAGGG - Intergenic
985434363 4:189914702-189914724 CAGCATCTACAAGTTGGAAAAGG + Intergenic
985861891 5:2477830-2477852 CAGCATCTACAAGGAGTCCAGGG - Intergenic
986667182 5:10114135-10114157 CAGCACCCACATCCTGTACATGG + Intergenic
986673334 5:10162524-10162546 CAGCAGCTAAATGTGGAACAAGG + Intergenic
987093273 5:14525994-14526016 CAGGATCAACATGTGATACATGG - Intronic
987525369 5:19043468-19043490 CAGCATCTACTTGTAATAGACGG - Intergenic
988617658 5:32791181-32791203 CAGCAACTCCATGCTGTTCAGGG - Exonic
993913487 5:93712282-93712304 CAACATCTACATTTTGAAGAGGG + Intronic
996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG + Intergenic
998769102 5:145521462-145521484 CTGGATCCCCATGTTGTACATGG - Intronic
1000600286 5:163265695-163265717 TAGCATCTACTTGAGGTACATGG + Intergenic
1002468899 5:179422943-179422965 CAGCATCTGCATGGTGTCCTCGG - Intergenic
1005517097 6:26565301-26565323 CATCATCTCCATTTTGTATAAGG + Intergenic
1008685519 6:53921975-53921997 CAGCATGTACATCTTTTAAATGG - Intronic
1008815677 6:55562380-55562402 GAACATCTACATGTATTACAGGG + Intronic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1013349080 6:109290065-109290087 CAGGATCTACGTGTGGCACAGGG - Intergenic
1013438611 6:110138950-110138972 CACCATCAACATGCTGTCCATGG + Intronic
1013488869 6:110625230-110625252 CAGAATCTACATTTTTAACAAGG + Intronic
1016076781 6:139805236-139805258 CACCATCAACATGTTGTCTATGG + Intergenic
1018944279 6:168335296-168335318 CAGCAGGTTGATGTTGTACACGG + Intergenic
1019560469 7:1653589-1653611 CAGCATCTACATGGAGCACCTGG - Intergenic
1020723962 7:11785472-11785494 CAGCATTTCCATTTTGTAAAGGG + Intronic
1020774906 7:12441196-12441218 AGGCATCTACATCTTGTAGAAGG - Intergenic
1023340461 7:39213974-39213996 CAGCATCTATAAGCTATACAGGG - Intronic
1024339700 7:48244682-48244704 CAGAATTTACATTTTGTCCAAGG + Exonic
1027971780 7:85092177-85092199 AAACAACTACATGTTGTTCATGG - Intronic
1029255773 7:99268519-99268541 CTGCATCTTGCTGTTGTACAAGG + Intergenic
1030610126 7:111680141-111680163 CACCATCTCCATCTTGAACAGGG - Intergenic
1031813450 7:126401906-126401928 CATCATCTCCAGGTTCTACATGG - Intergenic
1032117150 7:129126943-129126965 CAGCATCTGCATGGAGCACATGG + Intergenic
1035262336 7:157669963-157669985 CAGCATCTACGTGGTGCAGAGGG + Intronic
1037451084 8:19015526-19015548 TAGCAACTACATTTTGTACTGGG - Intronic
1039210169 8:35204640-35204662 CAACATCAACATGCTGTCCATGG + Intergenic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1042350018 8:67767516-67767538 CACAATCTACATGCTATACAGGG - Intergenic
1042496397 8:69458919-69458941 AAGCCTCTACATGTTTTGCAGGG - Intergenic
1042559263 8:70060570-70060592 CAAAGTCTACATGTTGTATATGG + Intronic
1043178439 8:77051878-77051900 CAGCACCTAGATGCTGTTCAAGG + Intergenic
1045038106 8:98193315-98193337 CAGGATCTACATGCTGGCCATGG + Intronic
1045429203 8:102097524-102097546 CAGCATCTACATGTCTCACCGGG - Intronic
1045549496 8:103158071-103158093 CAACATCTGCATGTTGTATTTGG + Intronic
1045798947 8:106079309-106079331 CAGCCTCTACATGATGGAAAAGG + Intergenic
1048794323 8:138135094-138135116 CATCATTTACATATTGTATATGG - Intronic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1052273917 9:26656835-26656857 CACCATCTATTTGTTGCACACGG - Intergenic
1053723446 9:40972806-40972828 CAGCATCTAAAAGTTGGAAAAGG + Intergenic
1054342517 9:63879190-63879212 CAGCATCTAAAAGTTGGAAAAGG - Intergenic
1058083960 9:100729184-100729206 CATAATCTCCATGTTGTACATGG + Intergenic
1058830455 9:108811755-108811777 CAGCTCCGACATGCTGTACAGGG - Intergenic
1059229510 9:112705866-112705888 AAGAATCTACATGTAATACAAGG - Intronic
1059670613 9:116488078-116488100 CATCATGTACATCCTGTACATGG - Intronic
1061229738 9:129308257-129308279 CAGTTTCTCCATCTTGTACATGG - Intergenic
1189717027 X:43877513-43877535 CGTTATCTACATGCTGTACAAGG - Intronic
1189733388 X:44045304-44045326 CAGCAACTCCATGTTGAATAGGG + Intergenic
1195636707 X:107125125-107125147 CTTCATCTTCATGTTGAACAGGG - Intronic
1197992118 X:132329530-132329552 CAACATCTAAATGTTGGACCTGG - Intergenic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1199267316 X:145843722-145843744 CTGCATCCAGATGTTGAACAGGG + Intergenic
1200224946 X:154412104-154412126 CAGCACCTCCCTGTTGTGCACGG - Exonic