ID: 944502083

View in Genome Browser
Species Human (GRCh38)
Location 2:200372289-200372311
Sequence CTGTTCAAGCAGAAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944502083_944502086 9 Left 944502083 2:200372289-200372311 CCAGCCAGCTTCTGCTTGAACAG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 944502086 2:200372321-200372343 CAGGAGTCTCACTACCTCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 426
944502083_944502085 -10 Left 944502083 2:200372289-200372311 CCAGCCAGCTTCTGCTTGAACAG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 944502085 2:200372302-200372324 GCTTGAACAGATTCTGTGACAGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944502083 Original CRISPR CTGTTCAAGCAGAAGCTGGC TGG (reversed) Intronic
900932536 1:5746212-5746234 CTGCTCAGGCAGCAGCTGACAGG + Intergenic
900977704 1:6027365-6027387 CTGCTCACTCAGTAGCTGGCAGG - Intronic
902514636 1:16983583-16983605 CTCTTCCCGGAGAAGCTGGCTGG + Intergenic
904623063 1:31787131-31787153 CTGTGCAAGCAGAAGCCGAGAGG - Intergenic
905473494 1:38209814-38209836 CTGGGGATGCAGAAGCTGGCGGG + Intergenic
908831192 1:68180165-68180187 GTGGTCAAGCAGAAGATGGTTGG - Intronic
913457246 1:119045901-119045923 ATGTTGAAGCAGAATCTGGTGGG - Intronic
914463915 1:147909356-147909378 CTGTCCAACCAGAGGCTGGTGGG - Intergenic
916763189 1:167835204-167835226 CTTTTCATGGAGCAGCTGGCTGG - Intronic
917845027 1:179013720-179013742 TTTTTCAAGTAAAAGCTGGCTGG + Intergenic
918039040 1:180901023-180901045 CTCTTCAAATAGAAGCTGGTTGG + Intergenic
919402528 1:197137640-197137662 CTGATAATGCAGAAGTTGGCTGG - Intronic
920032136 1:203043923-203043945 ATGTTCCAGAAGCAGCTGGCAGG - Intronic
920290894 1:204922362-204922384 CTGGTCAGGCAGGAGGTGGCAGG - Intronic
921929849 1:220746359-220746381 CTGTGCATGCAGCAGGTGGCGGG - Intergenic
922449288 1:225723800-225723822 CTGTTGAAGCATCAGCTGGGAGG + Intergenic
922819823 1:228476586-228476608 CAGTTCAAACAGGAGCTGGGAGG + Intergenic
1067570222 10:47366183-47366205 TTGTTCATGAAGCAGCTGGCAGG + Exonic
1067919527 10:50439332-50439354 CTTTCCAAGCAGAAACTGGTAGG + Intronic
1068966641 10:62918390-62918412 ATCTTTAAGCACAAGCTGGCTGG - Intronic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1071455682 10:85849840-85849862 CTGGTCAAGCAGGATCTTGCTGG - Intronic
1074657976 10:115616847-115616869 ATGGCCAGGCAGAAGCTGGCTGG + Intronic
1076150740 10:128160116-128160138 CTTTGAAACCAGAAGCTGGCAGG + Intergenic
1077663178 11:4086928-4086950 TTGATCAAGCAGCAGCTGGCAGG - Intronic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1082899322 11:58228424-58228446 CTGTGCACGCAGATGCTGGGTGG - Exonic
1085472517 11:76767366-76767388 GTTTTCAAGCAGAAGCTGGGTGG + Intergenic
1086119083 11:83286897-83286919 CTGTTAAAGCAGTTGTTGGCGGG - Intergenic
1087906965 11:103709657-103709679 ATGTTGAAGCAGAGGCTGGGTGG - Intergenic
1089639139 11:119835716-119835738 TTCTTCAAGCAGAAGCAGGAGGG - Intergenic
1090063473 11:123483766-123483788 GTGTTCAAGCAAAAGCTGGGTGG + Intergenic
1090281914 11:125463669-125463691 CTGTTTAGACAGCAGCTGGCTGG - Intronic
1091181063 11:133605249-133605271 CTGGTCAAGGAGCAGCAGGCTGG - Intergenic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1094573184 12:31659850-31659872 GTTTACAAGCCGAAGCTGGCCGG + Intronic
1100527472 12:95433122-95433144 CTTTTAAAACAGAAGCAGGCTGG + Intergenic
1101742804 12:107514105-107514127 TTGCTGATGCAGAAGCTGGCTGG + Intronic
1103580140 12:121908792-121908814 CTGGTCGAGGGGAAGCTGGCAGG + Intronic
1104261908 12:127192140-127192162 CTGTTCACACAGAACATGGCTGG + Intergenic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1106439396 13:29752096-29752118 GTGTTCAAGCAGAAGCTGTCAGG - Intergenic
1108720657 13:53128181-53128203 CTGGTCAAGCAGAAACTTTCTGG + Intergenic
1109213530 13:59562763-59562785 CCGTTCCAGCAGAAGCTGCAGGG + Intergenic
1110226976 13:73129873-73129895 CTGTTAAAGAAGAATGTGGCTGG + Intergenic
1111554895 13:89867892-89867914 GTGTTCAAGCAAAAGCTAGGGGG - Intergenic
1113574400 13:111383828-111383850 CTGCTCTAGCAGAAGCGGGCAGG - Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1115341341 14:32295958-32295980 CTGGTCAAGCAGTATCTGGAAGG + Intergenic
1116054619 14:39848217-39848239 TAGTTCAAGCAAAAGCTGGTTGG + Intergenic
1117108004 14:52418525-52418547 CTGTTAAAGCAGAATCTTGGAGG + Intergenic
1117830045 14:59741186-59741208 CTGTTCCAGGAGCAGCTGGAAGG - Intronic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1118847660 14:69559859-69559881 CTGTGCAGGCAGCAGCTTGCTGG + Intergenic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1120910790 14:89664992-89665014 CTGTTGAGGCAGAAATTGGCAGG + Intergenic
1121111822 14:91317854-91317876 CTGTACAAACAGGACCTGGCGGG - Intronic
1121885306 14:97537520-97537542 CTCTGCAGGCAGGAGCTGGCAGG - Intergenic
1122394283 14:101411771-101411793 CTCTCCAAGCAGGAGCTGGTTGG + Intergenic
1123188761 14:106546769-106546791 CAGTTCATGCAAAACCTGGCAGG - Intergenic
1125484585 15:40103410-40103432 CTGTTCCAGCAGCCGCTGTCTGG - Intronic
1126263753 15:46728265-46728287 TTAATCAAGCAGAAGCTGGAAGG - Intergenic
1126398356 15:48243273-48243295 GCATTCAAGCAGAGGCTGGCAGG + Intronic
1127173892 15:56332845-56332867 CTGATAAAGCAGAAGCTTGAAGG + Intronic
1127186701 15:56487948-56487970 CTCCTCAAGCAGCAGTTGGCGGG - Intergenic
1128201984 15:65816659-65816681 CTGTTAAAGCAAGAGATGGCTGG - Intronic
1128769376 15:70270392-70270414 CTCTTCAGGTAGAAGCTTGCTGG + Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131510434 15:93046876-93046898 CTGCTGGAGCAGCAGCTGGCTGG + Intronic
1131862556 15:96669803-96669825 CTTTTCAAGGAGAAACGGGCTGG + Intergenic
1134181893 16:12054546-12054568 ATGTTCCAGCTGAAGCTAGCAGG - Intronic
1136869387 16:33791523-33791545 CAGTTCATGCAAAACCTGGCAGG + Intergenic
1137408095 16:48205747-48205769 CAGTCCAAGCAGGACCTGGCTGG - Intronic
1139349219 16:66324914-66324936 CTGTCTAAGCAGATCCTGGCTGG + Intergenic
1139420011 16:66844371-66844393 CTCTTAAAGCAGCGGCTGGCGGG - Exonic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1141695908 16:85619317-85619339 CTGCTCAACCAAAAGCTGGGCGG - Intronic
1141832549 16:86517769-86517791 GTGTTCAAGGATAAGCTGGGTGG + Intergenic
1142038341 16:87876563-87876585 GTGTTCAAACAGAAGCTAGAAGG - Intergenic
1142239681 16:88939601-88939623 CTGTGCAAGCCGGAGCTGCCGGG - Intronic
1203102786 16_KI270728v1_random:1324545-1324567 CAGTTCATGCAAAACCTGGCAGG - Intergenic
1143809993 17:9463567-9463589 ATGTTCAACCAGGAGTTGGCTGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1145005618 17:19336159-19336181 CAGTTCTGGCAGAAGGTGGCTGG - Exonic
1145007742 17:19347071-19347093 CTGTTCCAGCAGCAGAAGGCCGG - Intronic
1146004227 17:29150663-29150685 CTATTCAAATTGAAGCTGGCCGG + Intronic
1147229969 17:39010377-39010399 GTATTCAAGCAGATGCTGGCTGG + Intergenic
1147463546 17:40591822-40591844 CTGTTAAAAGAGAAACTGGCCGG - Intergenic
1151743567 17:76000230-76000252 CTGTACAAGCAGGAGCGGGGCGG + Exonic
1153725154 18:7946877-7946899 CTGCCCAAGCTGAAGCTGCCTGG + Intronic
1155710748 18:28875661-28875683 ATTTGCAAGCAGAAGTTGGCTGG + Intergenic
1157897781 18:51485053-51485075 CTGCACAAGCAGAAGCTTACTGG + Intergenic
1163557481 19:18000991-18001013 CTGTTGAATCAGAAGCAGGCAGG - Intergenic
1164794771 19:31016907-31016929 ATTTCCAAGGAGAAGCTGGCTGG - Intergenic
925027289 2:620133-620155 CTGTCCAAGCAGGAGCTGAAGGG - Intergenic
927180221 2:20440657-20440679 CTGTTCAAGAAAATGCTGTCTGG + Intergenic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG + Intronic
934751836 2:96798839-96798861 CTGTTCAAGCCCAGGCAGGCAGG + Intronic
935515988 2:104039541-104039563 GTGTCCAAGCAGAAGCTGCAGGG + Intergenic
938418634 2:131125367-131125389 CTGTTAAAGCACCAGTTGGCGGG + Intronic
938804596 2:134794495-134794517 CTGTTCCAACAGAGGCTGGGAGG + Intergenic
939597841 2:144149285-144149307 GTGCTCAAGCAGCAGCTGTCAGG - Intronic
940709922 2:157149859-157149881 CTATACAAGCAGTAGCTGGCAGG + Intergenic
943002465 2:182345644-182345666 CTGTTTAAGCAGGAGCATGCTGG - Intronic
944502083 2:200372289-200372311 CTGTTCAAGCAGAAGCTGGCTGG - Intronic
946122285 2:217526568-217526590 CTCTTCTAGCAGCAGCTGGAGGG + Intronic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
947634069 2:231671349-231671371 GTGTCCCAGCAGAAGGTGGCCGG + Intergenic
1168799873 20:637526-637548 CTGTGCAAGCAGGACCTGGTGGG - Intergenic
1171003023 20:21433878-21433900 CCCTTCAAGCAGAAGCCAGCTGG + Intergenic
1171485311 20:25481595-25481617 CTGTTCAGACAGAGGCTGTCGGG - Intronic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1175185820 20:57179154-57179176 CTGTCCCAGCAGAAAGTGGCCGG + Intronic
1175985318 20:62761530-62761552 CAGTCCCAGGAGAAGCTGGCCGG + Exonic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1177421883 21:20870094-20870116 CTGTTCAAACAGAAGCAAGGAGG - Intergenic
1179418268 21:41215566-41215588 GTTTTCCAGCAGAAGCTGGATGG - Intronic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181691772 22:24566581-24566603 GTGTTCAAGCAGAGGCTGGGTGG + Intronic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182301514 22:29339773-29339795 ATCTCCAAGCAGAAGCAGGCAGG + Exonic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183083573 22:35472893-35472915 CAGCTCGAGCAGAGGCTGGCAGG - Intergenic
1183342185 22:37287555-37287577 CTCTTCCGGCAGGAGCTGGCGGG - Intronic
1184245279 22:43232693-43232715 GTGTGCAAGCAGAGGCTGACTGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1184751805 22:46490577-46490599 CTTTTCAAGCAGGACCTGGGAGG + Intronic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
950710950 3:14812289-14812311 CTTTCCAAGCAGTGGCTGGCTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
954530645 3:51315817-51315839 ATCTTCAAGCAGAAGCTCCCAGG + Intronic
956025343 3:64977315-64977337 CTGTGGAAGCTTAAGCTGGCAGG + Intergenic
956862577 3:73339259-73339281 CTGTTCAAACACAAGAAGGCAGG - Intergenic
957199504 3:77113886-77113908 CTATACATGTAGAAGCTGGCAGG + Intronic
961754778 3:129121416-129121438 CTGTTCAAGCTGGTGCTGGTGGG - Exonic
963878319 3:150501182-150501204 ATGTCCAAGCAGAAGTTTGCTGG - Intergenic
964763320 3:160154770-160154792 CTGTGAGAGAAGAAGCTGGCTGG + Intergenic
966657298 3:182373929-182373951 ATGTTCAAGAAGAAGCTGATTGG - Intergenic
968422448 4:497159-497181 CTGTCGATGCAGAAGCAGGCAGG + Intronic
973707036 4:53591410-53591432 CTCTCCAAGCAGCAGCAGGCAGG + Exonic
977404062 4:96574043-96574065 CAATTCAAACAGAGGCTGGCAGG + Intergenic
979486732 4:121278849-121278871 CTGGGCAAGCTGAACCTGGCAGG + Intergenic
979838728 4:125408618-125408640 CTGTTCGAGCAGAAGATGGTGGG + Exonic
983566635 4:169159914-169159936 CTGTTCAACCAGAAGATGAATGG - Intronic
986686510 5:10279515-10279537 CTGTTCAAGGACCAGCTGACAGG - Exonic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
989780011 5:45253695-45253717 CTTTTCATGGAGAAGCTTGCTGG + Intergenic
990633541 5:57697134-57697156 CAGTTCAGCCCGAAGCTGGCTGG + Intergenic
993699541 5:91101883-91101905 CTGTTCCACCAGAAAATGGCAGG - Intronic
1001030332 5:168257908-168257930 CCTTTCAATCAGGAGCTGGCCGG - Intronic
1002169143 5:177365828-177365850 CTGACCAAGTAGAACCTGGCCGG + Intronic
1002178587 5:177417340-177417362 CTGTTCAAGGAGACGTTGGGGGG + Intronic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1005637709 6:27767251-27767273 CAGTTCAAGCAGAAGTGTGCGGG + Intergenic
1007545693 6:42692287-42692309 CTGTTCCAGGAAATGCTGGCTGG - Exonic
1007689509 6:43690489-43690511 ATGTTCAAGCAGAACTTGACTGG + Intergenic
1008329704 6:50230030-50230052 CTGCTCAAGCAGCAGTTGTCGGG - Intergenic
1011954119 6:93004134-93004156 CTCTCCAAGGAGAAACTGGCAGG + Intergenic
1012004664 6:93697681-93697703 ATCTTCAAACAGAAGCTGGGAGG - Intergenic
1012914726 6:105157192-105157214 CTGTTCCAGGAGCAGCTGGAAGG - Intergenic
1013640001 6:112064871-112064893 CTGTTCATACCAAAGCTGGCTGG + Exonic
1014299051 6:119657545-119657567 CTTTTCAGGAAGAAGCTTGCAGG - Intergenic
1015985679 6:138881946-138881968 CTGTCCATGCAAAAGCTAGCAGG + Intronic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1020009502 7:4800441-4800463 CTGTTCAGGCAGAATGTGACCGG + Intronic
1022286920 7:28962218-28962240 CTGCTCCAGCAGAAGTGGGCTGG - Intergenic
1022836569 7:34122218-34122240 CTATTCAAGCAGAATCTGTTGGG - Intronic
1022943528 7:35260952-35260974 CTGTTCTAGAAGAAGCTGTTCGG + Intergenic
1023222906 7:37938608-37938630 CAGTTAAAGCAAAAGCAGGCTGG - Intronic
1026528077 7:71173140-71173162 CTGTTCCAGGAGAACCTGGAGGG + Intronic
1029282630 7:99446226-99446248 CTGTGCTAACAGAAGGTGGCTGG - Intronic
1030309935 7:108058977-108058999 ATATTTGAGCAGAAGCTGGCAGG - Intronic
1032364305 7:131285052-131285074 CTTTTCCAGCAGAAGCTGCAGGG + Intronic
1034092485 7:148376857-148376879 CTGTTAGAGCAGGAGCTGACAGG + Intronic
1034997392 7:155586866-155586888 CTTTTCAAGCACAAGCTAGAAGG - Intergenic
1035237558 7:157508730-157508752 CTGTTAAAGCTGGAGTTGGCTGG + Intergenic
1035294773 7:157860844-157860866 CAGCTCAGGCAGCAGCTGGCCGG + Intronic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036036978 8:5030240-5030262 TTGTTCAAGAGGAAGCTGGAGGG + Intergenic
1041191988 8:55364127-55364149 CTGCTCAGGCAGAGGCTGCCTGG - Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1044747497 8:95384922-95384944 CTGGTCAAGGTGAAGCTGGCAGG + Intergenic
1045853226 8:106728987-106729009 CTGTTCAAGAATTAGCTGACAGG + Intronic
1047034068 8:120915221-120915243 CTGTTTAGGCAGCAGCTTGCAGG + Intergenic
1047940936 8:129826890-129826912 TTCTTCAAGCAGAAGATGCCTGG + Intergenic
1048151294 8:131897461-131897483 CTGTTAAAGGGTAAGCTGGCTGG + Intergenic
1049417308 8:142500974-142500996 CAGTGCAAGCAGAACCAGGCTGG - Intronic
1050194235 9:3063702-3063724 CTGCTCAGGCAGATGCTGGCTGG + Intergenic
1056460002 9:86800314-86800336 TTGTGCAAACTGAAGCTGGCGGG - Intergenic
1056494238 9:87140504-87140526 CTGGTCAAGTTGAAGCAGGCAGG + Intergenic
1056820565 9:89838876-89838898 GTGATCCAGCAGACGCTGGCTGG - Intergenic
1057294549 9:93827653-93827675 CTGTGCTGGCAGAAGCTTGCTGG - Intergenic
1058694181 9:107545451-107545473 CTGTTTAAGCAGAACCGGGGTGG - Intergenic
1185836171 X:3347095-3347117 GTGTGCAAGCAGGAGCGGGCTGG + Intergenic
1191952346 X:66606209-66606231 TAGTTGTAGCAGAAGCTGGCTGG + Intronic
1193758373 X:85436460-85436482 GTGCTCAGGCAGAAGCCGGCTGG + Intergenic