ID: 944502358

View in Genome Browser
Species Human (GRCh38)
Location 2:200375205-200375227
Sequence CTGGAGTTACGTGGGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944502352_944502358 5 Left 944502352 2:200375177-200375199 CCAACAGCAATGAAAATCCCTCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 944502358 2:200375205-200375227 CTGGAGTTACGTGGGTATATAGG 0: 1
1: 0
2: 0
3: 4
4: 69
944502351_944502358 25 Left 944502351 2:200375157-200375179 CCGTAAAGTGCATGTAGGTGCCA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 944502358 2:200375205-200375227 CTGGAGTTACGTGGGTATATAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944502358 Original CRISPR CTGGAGTTACGTGGGTATAT AGG Intronic
911516372 1:98872956-98872978 CTGGGTTTACTAGGGTATATGGG - Intergenic
919005994 1:191900422-191900444 CGGGAGTTATGAGGATATATGGG - Intergenic
920904208 1:210145690-210145712 CTGGAGTGGCATGTGTATATGGG - Intronic
1064692272 10:17930464-17930486 CTGGAGCTAAGTGGCTATAATGG + Intergenic
1082824698 11:57568825-57568847 CTGGAGTTCAGTGGCGATATCGG + Intergenic
1092313309 12:7382717-7382739 CTGGAGTTACCTGGGTCTTGGGG - Intronic
1094649958 12:32366175-32366197 CTGGAGTTATGTAACTATATAGG + Intronic
1108034208 13:46271151-46271173 CTTGAGTTATGTGTGTATTTGGG + Intronic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1110757575 13:79193828-79193850 CCCAAGTTATGTGGGTATATTGG + Intergenic
1115795497 14:36930823-36930845 CTGTAGTTAGGTGGATATGTGGG - Intronic
1116263310 14:42658793-42658815 CTGGAGTTAGTTGGGAATTTCGG + Intergenic
1118317228 14:64732698-64732720 CTGGAGCTGGGTGGGTATAGAGG + Intronic
1120682554 14:87498080-87498102 CTGGAGTTACAGGGCTATAATGG + Intergenic
1125707617 15:41753459-41753481 CTAGAGTTATGTGGATATATAGG - Intronic
1126621404 15:50643831-50643853 CTGCAGGTACTTGGGTAAATTGG - Intronic
1127159592 15:56167364-56167386 CTTCAGTTACGTTGGTCTATCGG - Intronic
1128882948 15:71260362-71260384 ATGGAATTAAGTGGGTACATAGG - Intronic
1129766510 15:78172918-78172940 CTGGAGTCACGTGGTTCTAGGGG - Intronic
1140505155 16:75466889-75466911 CTGGAGTTAGCTGGGACTATAGG - Intergenic
1141780862 16:86159854-86159876 CTTGAGCTAGGTGGCTATATGGG - Intergenic
1147617208 17:41836436-41836458 TTGGGGTTACGTGGGTAGGTAGG + Intronic
1155822079 18:30390893-30390915 CTGGAGTTTCGGGTTTATATGGG - Intergenic
1160134604 18:76261845-76261867 CTGGAATTATGTGGGTTTTTCGG + Intergenic
1161618416 19:5285497-5285519 CTGGGGTTTTGTGGGTGTATAGG - Intronic
928337587 2:30411186-30411208 CTGGAGTTTCTTGGGCCTATAGG - Intergenic
943222605 2:185130172-185130194 CTGGAGCTACTTTTGTATATAGG + Intergenic
944502358 2:200375205-200375227 CTGGAGTTACGTGGGTATATAGG + Intronic
947801287 2:232929643-232929665 CTGGAGATACCTGGGTCCATGGG - Intronic
1169489468 20:6058865-6058887 CTGGAGTTCTGGGGGTAAATGGG - Intergenic
1171100071 20:22374580-22374602 CTGGAGATACCAGGGTAGATAGG - Intergenic
1173039657 20:39450460-39450482 TTGGAGTTACCTGGGTACATTGG - Intergenic
1176242855 20:64083146-64083168 CTGGCGTTCTGTGGGTCTATGGG - Intronic
1178837894 21:36113786-36113808 CCGGAGTTACGTGTGTTTACTGG - Intergenic
1179052685 21:37902040-37902062 CTGGAGTCATGTGGTTCTATGGG - Intronic
1180620970 22:17161579-17161601 CTGGAGTTGGGTGGGTATGGTGG + Intronic
956842720 3:73155389-73155411 ATGGACTTCCGTTGGTATATAGG + Intergenic
961434200 3:126905378-126905400 CAGGAGTTTCTTGGGTAGATAGG + Intronic
962278567 3:134033477-134033499 CAGGAGTCAGATGGGTATATGGG + Intronic
964218931 3:154322478-154322500 CTGGAGGTAAGTGGTTAGATTGG + Intronic
964315880 3:155443910-155443932 CTGGAGTTAAGGAGGGATATTGG - Intronic
968666424 4:1824750-1824772 CTGGAGCTCCGTGGGGATATGGG - Intronic
969353569 4:6612344-6612366 CTGGTGTTTCGTGGGTGTAGAGG + Intronic
969932774 4:10647690-10647712 TTGGAATTACTTGGATATATAGG - Intronic
970463844 4:16303899-16303921 CTGGACTTGCCTGGGTCTATGGG - Intergenic
971677656 4:29654369-29654391 CTGGAGGTACGAGAGGATATTGG - Intergenic
978237275 4:106474264-106474286 CTGGAGTTAGGTGGGAACAGGGG + Intergenic
985957130 5:3274285-3274307 CTGGAGTTAAATGGGGAGATAGG - Intergenic
991187765 5:63830457-63830479 CAGGAGTTAGGTGGGTACAGGGG + Intergenic
991187871 5:63831743-63831765 CAGGAGTTAGGTGGGTACAGGGG - Intergenic
993168995 5:84392214-84392236 CAGGAGTTATGTGGTTATCTAGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1004796061 6:19086451-19086473 GTGGGGTTAGGAGGGTATATAGG - Intergenic
1007047233 6:38788947-38788969 CTGGAGTAACGTTGGTATTGTGG + Intronic
1007086780 6:39153717-39153739 CTGGTGGAACGTAGGTATATTGG - Intergenic
1009955304 6:70446300-70446322 CTGGAATTACGGTGGTATAGTGG - Intronic
1012808034 6:103920065-103920087 ATGGTCTTACGTGGGTTTATTGG - Intergenic
1018676592 6:166227495-166227517 CTGCAGTTACAAGGGTATATTGG + Intergenic
1029136176 7:98373784-98373806 CTGGAGATACCTGTGTAAATAGG - Intronic
1037075474 8:14711879-14711901 CTGGAGTTGCCTCAGTATATTGG - Intronic
1043738892 8:83782636-83782658 CTGGAGATACTTAGTTATATGGG - Intergenic
1044425548 8:92045898-92045920 CTGAACTTAAGTGGCTATATAGG - Intronic
1050366882 9:4880971-4880993 CGGGAGTTATGTGGGTAACTTGG + Intronic
1051332703 9:16039785-16039807 CTTGAGCTACGTGGGTGTCTGGG + Intronic
1052392629 9:27898728-27898750 CAAGAGTTACCTGGGAATATAGG - Intergenic
1055342532 9:75299860-75299882 ATGTAGTTATGTGGTTATATAGG - Intergenic
1058879335 9:109273061-109273083 CTGGTGTTAAGTGAGTTTATAGG - Intronic
1185873285 X:3682102-3682124 CTTGGGGTCCGTGGGTATATGGG + Intronic
1189464978 X:41271671-41271693 CGGGAGTCAAGGGGGTATATGGG + Intergenic
1190594744 X:52041645-52041667 ATGAAGTTACTTGGGTATTTTGG + Intergenic
1190614080 X:52212428-52212450 ATGAAGTTACTTGGGTATTTTGG - Intergenic
1192972860 X:76252237-76252259 CTGGAGTTAGTTGGGAATTTGGG + Intergenic
1195559352 X:106265901-106265923 CTGGACTTACCTGGGTCTAGGGG - Intergenic
1198104160 X:133446885-133446907 CTGGAGATAAGAGGATATATTGG - Intergenic