ID: 944509330

View in Genome Browser
Species Human (GRCh38)
Location 2:200449001-200449023
Sequence GGGCAAATACACATATAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944509327_944509330 4 Left 944509327 2:200448974-200448996 CCGGGATCTATTCTGAAATTGTG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG 0: 1
1: 1
2: 0
3: 18
4: 277
944509326_944509330 16 Left 944509326 2:200448962-200448984 CCGAAATAAGCTCCGGGATCTAT 0: 1
1: 0
2: 0
3: 5
4: 46
Right 944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG 0: 1
1: 1
2: 0
3: 18
4: 277
944509322_944509330 29 Left 944509322 2:200448949-200448971 CCAGTCCAATAAACCGAAATAAG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG 0: 1
1: 1
2: 0
3: 18
4: 277
944509323_944509330 24 Left 944509323 2:200448954-200448976 CCAATAAACCGAAATAAGCTCCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG 0: 1
1: 1
2: 0
3: 18
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944509330 Original CRISPR GGGCAAATACACATATAACA TGG Intronic
901351116 1:8597676-8597698 GTGCACATTCATATATAACAGGG - Intronic
905482601 1:38271677-38271699 GGGCAAATAAACATCAGACAGGG - Intergenic
907322490 1:53613890-53613912 AGGCAAATTCATATAAAACATGG - Intronic
908955740 1:69624287-69624309 TGGCTAATAAACATATAAAAAGG - Intronic
909645611 1:77913476-77913498 TGGCAAATAAACATATGAAAAGG + Intronic
910526677 1:88186667-88186689 GGGAGATTACACATATAACTGGG + Intergenic
910661814 1:89681585-89681607 GGGCAAAGGCACATCTTACATGG + Intronic
910748898 1:90605921-90605943 GGGCAAAAAAACATATAAAAAGG + Intergenic
911571277 1:99520121-99520143 AGGAAAATAAAGATATAACAGGG + Intergenic
912006052 1:104903077-104903099 GGGCAAAGACACATCTTACATGG + Intergenic
912136681 1:106668543-106668565 TGGCAAAGAGACATATAAAAAGG + Intergenic
914394400 1:147251012-147251034 GGGCAAAGTCACATCTTACATGG - Intronic
914708594 1:150192097-150192119 GGGCAAATATACACACAATAAGG + Intergenic
916323550 1:163532803-163532825 TGGCAAATACAGATATCACTAGG + Intergenic
916517116 1:165528789-165528811 GAGCAAAAACACATCTTACATGG - Intergenic
917033133 1:170717097-170717119 GAGAAAAGACACAAATAACAGGG - Intronic
917150638 1:171940699-171940721 GGGCAAATAGACATTTAAAATGG - Intronic
917183574 1:172325949-172325971 GTGCACATATACATATAACCTGG + Intronic
921013692 1:211168116-211168138 GGGGAAACAAACACATAACATGG + Intergenic
921240568 1:213177256-213177278 GAGCAAATATACTTAAAACATGG - Intronic
922407439 1:225330029-225330051 TGGCAAAAAGACATATAAAAAGG + Intronic
1063261698 10:4396546-4396568 AGGCAACTACCCACATAACATGG + Intergenic
1063926553 10:10983433-10983455 GAGTAAACACATATATAACATGG + Intergenic
1064013007 10:11750712-11750734 GGGAAACAACACATATAAAATGG + Intronic
1064741300 10:18437876-18437898 AGGCAAATTGACATAGAACATGG + Intronic
1064793598 10:18987491-18987513 GAGCAAATTCACATCTTACATGG + Intergenic
1065277763 10:24103003-24103025 GGGCAAAGTCACATCTCACATGG - Intronic
1065781530 10:29173116-29173138 GAGCAAATGCACATCTTACATGG + Intergenic
1066142494 10:32520482-32520504 TGGCAAATAGGCATATAAAAAGG - Intronic
1066184114 10:32992381-32992403 GAGCAAAGGCACATATTACATGG + Intronic
1066185118 10:33003018-33003040 GGGCAAATCCATATTTTACATGG + Intronic
1066581265 10:36885086-36885108 GTGCAAATACACTTATACTAGGG - Intergenic
1066586448 10:36941938-36941960 GGGCAAAAGCACATCTTACATGG + Intergenic
1068331638 10:55578762-55578784 GAGCAAAGTCACATCTAACATGG + Intronic
1069967478 10:72132888-72132910 GGGCAAGAACATATATAGCATGG - Intronic
1070095394 10:73332686-73332708 GGGCAAATCCAAAGACAACAGGG + Intronic
1071316051 10:84399390-84399412 TGGGAAATACACATACACCATGG - Intronic
1073985783 10:109207401-109207423 AGGCAACTACACAGATTACAGGG + Intergenic
1076116260 10:127903788-127903810 GAGCAAAGACACATCTTACACGG + Intergenic
1078806385 11:14709716-14709738 GGGGAAATAAACCTATTACAAGG - Intronic
1079166504 11:18048897-18048919 TGGCAAATAGACATATGAAAAGG + Intergenic
1080219092 11:29879588-29879610 GGGGAAAAACACAGATAAAACGG - Intergenic
1081386502 11:42479157-42479179 GGGCAAAGGCACATCTTACACGG - Intergenic
1081689033 11:45063807-45063829 CAGAAAACACACATATAACAAGG + Intergenic
1083790472 11:64981894-64981916 TGGCAAATAGACATATGAAAAGG - Intergenic
1085959230 11:81440156-81440178 GAGCAAAGACACATCTTACATGG + Intergenic
1087108718 11:94439134-94439156 GGTCAAATTCTCTTATAACAAGG - Intronic
1088633788 11:111799593-111799615 GGGCAAATCCACATAGTAAATGG + Intronic
1089664275 11:120007845-120007867 GAGCAAATATACATCTTACATGG - Intergenic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1092908804 12:13126915-13126937 TGGCAAATAAGCATATGACAAGG - Intronic
1092927553 12:13285586-13285608 TGGCCAACACACATATAAAAAGG + Intergenic
1094136720 12:27135475-27135497 TGGCAAATAGACATATGAAAAGG + Intergenic
1094353155 12:29548568-29548590 GAGCAAAGACACATCTTACATGG - Intronic
1094397475 12:30024088-30024110 GAGCAAAGACACATCTTACATGG + Intergenic
1094767715 12:33617410-33617432 GAGCAAAGGCACATATTACATGG - Intergenic
1095252933 12:39999683-39999705 GGGCAAATGCAAAGATCACAAGG - Intronic
1095939939 12:47719627-47719649 GCGCAAAGACACATCTTACATGG - Intronic
1096398542 12:51286150-51286172 GGGTAAATATAAATATAACTGGG - Intronic
1097317140 12:58183650-58183672 GAGAAAATACAGAAATAACAGGG - Intergenic
1097996183 12:65890268-65890290 GTGCAAAGAGACATAAAACATGG - Intronic
1098371980 12:69769098-69769120 GGCGAAATACACATCTAACATGG - Intronic
1098390032 12:69960097-69960119 GAGTAAATACACATATATCAAGG + Intergenic
1098999254 12:77158646-77158668 GGGAAAGTACACATCCAACAGGG - Intergenic
1099088772 12:78279265-78279287 GAGCAAATACACATCTTACATGG - Intergenic
1101071706 12:101082262-101082284 GAGCAAAGACACATCTTACATGG - Intronic
1104212314 12:126700779-126700801 GAGCAAAGACACATCTTACATGG - Intergenic
1106004684 13:25757732-25757754 GGTCAGGAACACATATAACAGGG - Intronic
1106629265 13:31453371-31453393 AGGCAAATTCACATATAAAAAGG + Intergenic
1107265352 13:38546639-38546661 GGGGAAATACAAATATAGAAAGG + Intergenic
1107431231 13:40342291-40342313 GAGCAAAGACACATCTTACATGG + Intergenic
1107690102 13:42945196-42945218 GAGCAAAGACACATCTTACACGG + Intronic
1108757690 13:53523478-53523500 GGGCAAACACTGAAATAACAGGG - Intergenic
1110073309 13:71206721-71206743 GAGCAAAGACACATCTTACATGG - Intergenic
1111036906 13:82686761-82686783 GAGCAAATACAGTTATAAAATGG + Intergenic
1111105649 13:83642420-83642442 GGGTAAATACAGATATTCCAAGG + Intergenic
1111256184 13:85671816-85671838 GGGCAAAATCACCTAAAACAAGG - Intergenic
1111435117 13:88196534-88196556 GGGCAAAGGCACATCTTACATGG - Intergenic
1111510491 13:89255490-89255512 AGGCAAAGACACATCTTACATGG - Intergenic
1113765324 13:112877476-112877498 TGGCAGACACACATGTAACAAGG + Intronic
1113920313 13:113904304-113904326 GAGCAAAGACACATCTTACAGGG - Intergenic
1117208682 14:53472303-53472325 GGGCAAATAAACTTTTACCATGG - Intergenic
1117618251 14:57556617-57556639 ATGCAAATAAAAATATAACAAGG + Intergenic
1118113218 14:62746232-62746254 GACCAAATACAGATATTACATGG - Intronic
1120325226 14:83015424-83015446 TGTCAAATACACATAAAAAATGG - Intergenic
1120512523 14:85432941-85432963 GTGCAAATACATATACACCATGG + Intergenic
1121334653 14:93069826-93069848 GGGTAAAAACACATATACAAAGG + Intronic
1121795877 14:96735079-96735101 GTGCAAAGACAAATATACCAAGG + Intergenic
1122360164 14:101154473-101154495 GAGCAAAGACACATCTTACATGG - Intergenic
1202847819 14_GL000009v2_random:197383-197405 TTGCAAACACACATATAAAAGGG - Intergenic
1202917294 14_GL000194v1_random:187922-187944 TTGCAAACACACATATAAAAGGG - Intergenic
1126326048 15:47478868-47478890 GGGCAAAGGCACATCTTACATGG + Intronic
1126972683 15:54135079-54135101 TGGCTAATACACATTTAAAAAGG - Intronic
1130735533 15:86544559-86544581 GGGCAAAGTCACATCTTACATGG + Intronic
1134004983 16:10812942-10812964 GGGGAAAAACACATACAGCATGG + Intronic
1137812605 16:51367202-51367224 GTGTATATACACATATAACAAGG + Intergenic
1137884959 16:52093081-52093103 GTGCATATACACATATTTCAGGG + Intergenic
1138348530 16:56334347-56334369 GGGAAATTACACATGAAACATGG + Intronic
1140602381 16:76492737-76492759 GGGCAAAGCCACATCTTACATGG - Intronic
1145014323 17:19386890-19386912 GGGCAAATGCAAAGAGAACAGGG - Intronic
1149862529 17:60131042-60131064 TGGCAAACAAACATATAAAAAGG - Intergenic
1150960857 17:69910778-69910800 GGGCAAAGTCACATCTTACATGG + Intergenic
1153806660 18:8714548-8714570 GAGCAAAGACACATATTACATGG + Intronic
1154944638 18:21149415-21149437 TGGCAAATAAACATATTAAAAGG - Intergenic
1156584878 18:38421040-38421062 AGGCAAATACGCATAAAATAAGG + Intergenic
1157117486 18:44875645-44875667 GGCTCAATACACATATACCAAGG + Intronic
1157230242 18:45909056-45909078 CGGCAAATACACAAATTACTGGG + Intronic
1159578943 18:70213160-70213182 TGGCCAATACACACATAAAAAGG + Intergenic
1164701537 19:30288120-30288142 GGGCACATACACAGATGACTGGG + Intronic
1166164807 19:40979891-40979913 GAGCAAAGACACATCTTACATGG + Intergenic
1168146647 19:54423169-54423191 GAACAAATACACATGTCACACGG - Intronic
926799125 2:16643648-16643670 GGGCGAATACAGATAGAACTGGG - Intronic
930081311 2:47451263-47451285 GAGCAAAGGCACATATTACATGG + Intronic
930604210 2:53475807-53475829 TGTCATATGCACATATAACAGGG - Intergenic
933388624 2:81643180-81643202 GGGCAAACAGACATATGAAAAGG + Intergenic
933671133 2:85008195-85008217 GCAGAAATACACATAAAACAAGG - Intronic
933879384 2:86654058-86654080 GGGCAAATATACATCTAATAAGG + Intronic
935577748 2:104728484-104728506 GAGCAAAGGCACGTATAACATGG - Intergenic
937106587 2:119321474-119321496 GAGCAAAGGCACATCTAACATGG + Intronic
937612162 2:123875365-123875387 GGGCAAAGTCACATCTTACATGG - Intergenic
937798023 2:126048637-126048659 GAGCATATACACATAAAATAAGG - Intergenic
939572287 2:143854863-143854885 AGGCAAATACACATATAACAAGG + Intergenic
939780929 2:146446603-146446625 GAGCAAATGCACATCTTACATGG + Intergenic
939839648 2:147171728-147171750 GGGTAAATCCACATTTTACAAGG + Intergenic
941047376 2:160691635-160691657 TGGCAAATAGAAATATAAAAAGG - Intergenic
942138808 2:172956393-172956415 GGGCTAAGACAAATATACCAGGG - Intronic
943238183 2:185348669-185348691 GAGCAAAGACACATCTTACAAGG - Intergenic
943279275 2:185910464-185910486 GAGCAAAGACACATCTTACATGG - Intergenic
943702654 2:191003596-191003618 GGGGAAGCACACATATCACATGG - Intronic
943792408 2:191948345-191948367 AGGGAAATACAAATAAAACATGG - Intergenic
944509330 2:200449001-200449023 GGGCAAATACACATATAACATGG + Intronic
944881626 2:204018655-204018677 TAGCAAATACAAATATAAGATGG - Intergenic
947036259 2:225860609-225860631 GAGCAAAGTCACATATTACATGG + Intergenic
947039670 2:225902640-225902662 TGGCAAATAGACATATGAAAAGG + Intergenic
1169312613 20:4559021-4559043 TGGCAAATAAACATATGAAAAGG + Intergenic
1170145996 20:13174996-13175018 GAGCAAAGTCACATATTACACGG - Intergenic
1170485413 20:16810769-16810791 AGGCACATACACCTTTAACAAGG - Intergenic
1173109426 20:40172517-40172539 GGGCAAAATCACATCTTACATGG + Intergenic
1173796494 20:45864459-45864481 AGCCAAATACACATATTACTGGG + Intronic
1174092843 20:48063083-48063105 GGGCAAAGTCACATCTTACATGG - Intergenic
1177013720 21:15758492-15758514 GGGCAAAGGCACATCTTACATGG - Intronic
1177201653 21:17963468-17963490 GGGCAAAGGCACATCTTACATGG + Intronic
1177468314 21:21519561-21519583 GGACAAATTAACAAATAACAGGG - Intronic
1177654993 21:24005133-24005155 GAGCAAAGACACATCTTACATGG + Intergenic
1178102211 21:29281905-29281927 GAGCAAAGACACATCTTACATGG + Intronic
1178208454 21:30498623-30498645 TGGCCAATACACATATAAAATGG - Intergenic
1178563118 21:33657687-33657709 AGGCAAATCCACATATAAGCAGG + Intronic
1181481578 22:23203171-23203193 GGGCAGAAACTCATATAAAAAGG - Intronic
1182405629 22:30126965-30126987 TGGCCAATAAACATATAAAAAGG - Intronic
1184080570 22:42216638-42216660 TGGCAAATACAAATACCACATGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951135912 3:19103903-19103925 GGTGAAAGACACATATTACATGG - Intergenic
952480364 3:33754744-33754766 GGGCAAAGGCACATCTTACATGG + Intergenic
955045425 3:55354961-55354983 GAGCAAAGTCACATATCACATGG - Intergenic
955206651 3:56901832-56901854 GCAGAAATACACATAAAACAAGG - Intronic
957212425 3:77276833-77276855 GAGCAAAGTCACATATTACATGG + Intronic
958847456 3:99282152-99282174 TGGCAAATAGACATATAAAAAGG + Intergenic
960294768 3:115929538-115929560 GTGAAAATACACATCAAACAGGG + Intronic
962758507 3:138486512-138486534 GGGCAAAAACAAAGATCACAAGG + Intergenic
962758510 3:138486539-138486561 GGGCAAAAACAAAGATCACAAGG + Intergenic
963539341 3:146566158-146566180 GAGCAAAGACACATCTTACATGG + Intergenic
963627196 3:147688707-147688729 GAGCAAAGACACATTTTACATGG + Intergenic
964038694 3:152231277-152231299 TGGCAAATAGACATATGAAAAGG + Intergenic
965359020 3:167714080-167714102 GGGCAAAGACACATCAAAAAAGG + Intronic
965917494 3:173868404-173868426 TGGCAAATATGGATATAACAGGG + Intronic
970109512 4:12621825-12621847 TGGCAAATACAGAAAGAACAAGG + Intergenic
970228143 4:13881012-13881034 GGTCACATTCACAGATAACAAGG - Intergenic
970457175 4:16236461-16236483 CTGCAAATACAAATATTACAAGG + Intergenic
970539520 4:17063457-17063479 TGGCATATATATATATAACATGG + Intergenic
970569724 4:17367946-17367968 GAGCAAAGTCACATCTAACATGG - Intergenic
971112674 4:23606454-23606476 GAGCAAAGACACATCTTACATGG - Intergenic
971423555 4:26494923-26494945 GGGCAAAGTCACATCTTACATGG - Intergenic
971427264 4:26528850-26528872 ACACAAATACACATAAAACAAGG - Intergenic
971764225 4:30808611-30808633 GGGGAAAAATACATATAACTGGG + Intronic
971841179 4:31854427-31854449 TGGCCAATACACATGTAAAAAGG + Intergenic
972402010 4:38713996-38714018 GGGCAAAGTCACTTATTACATGG + Intergenic
972928828 4:44046293-44046315 TGGCAAATAGGCATATAAAACGG + Intergenic
974189105 4:58480572-58480594 GGGCATATAAACATAGACCAAGG - Intergenic
974953129 4:68605187-68605209 GAGCAAATTCACATATCACAAGG - Intronic
975336032 4:73176180-73176202 TGGCAAATACACATATGAAAAGG + Intronic
976105664 4:81614435-81614457 GGGTAAATACACAAATAGAAAGG + Intronic
976836493 4:89380538-89380560 GAGCAAATGCACATCTTACATGG + Intergenic
978041723 4:104072661-104072683 GGGCAAAGAAAGATAAAACATGG - Intergenic
978204607 4:106065972-106065994 GGCCAAATACAAATACAAAAGGG + Intronic
979657409 4:123211548-123211570 TGGCCAATTCACATATAATAGGG - Intronic
980324628 4:131325018-131325040 GGGAAAAAACACATACCACATGG - Intergenic
980347564 4:131641695-131641717 TGGCAAATAGGCATATAAAAAGG + Intergenic
981821917 4:148897175-148897197 GAGCAAATGCACATCTTACATGG + Intergenic
981994317 4:150959183-150959205 GAGCAAAGACACATCTTACATGG + Intronic
982219666 4:153113757-153113779 GAGTAAATACACATATCAGAGGG + Intergenic
985701266 5:1374502-1374524 TTGCAAATACACAAATCACATGG + Intergenic
986220383 5:5763617-5763639 GAGCAAAGACACATCTTACATGG - Intergenic
986528330 5:8704948-8704970 GAGCAAAGGCACATATTACATGG - Intergenic
986649800 5:9951913-9951935 GTGCAAAAAGACATATATCAAGG + Intergenic
988077816 5:26374733-26374755 GGGCTAAGACACATATTAAATGG + Intergenic
990723804 5:58730925-58730947 GAGCAAAAACACATTTTACATGG + Intronic
993911774 5:93692156-93692178 GCTCAAATTCACACATAACAAGG + Intronic
994831018 5:104784277-104784299 GAGCAAATTCACATCTTACATGG + Intergenic
996062759 5:119050154-119050176 GGGCAAAGTCACATTTTACACGG - Intronic
997228969 5:132228942-132228964 ACGGAAATACACATAAAACATGG + Intronic
997744174 5:136284286-136284308 GTGCACATACACACATATCATGG - Intronic
997938565 5:138135827-138135849 GGGGAAATAAACATTTAAAAAGG - Intronic
998695768 5:144637431-144637453 TGGCAAATATACATATGAAAAGG + Intergenic
1003756188 6:9123280-9123302 AGGGAAACACACATAAAACAAGG + Intergenic
1004813154 6:19281979-19282001 TGCCAAATTCACAAATAACACGG + Intergenic
1008423189 6:51327024-51327046 AGGCAAATATACATCTACCATGG - Intergenic
1009578732 6:65503232-65503254 TGGTAAATAAACATATAAAAAGG - Intronic
1009680489 6:66885481-66885503 GGGAAAATACTCATAAATCAAGG + Intergenic
1009897741 6:69774235-69774257 GAGCAAAGTCACATCTAACATGG - Intronic
1011637779 6:89390389-89390411 AGGCCAATACACATATGAAAAGG + Intronic
1012687479 6:102270335-102270357 GGCAAAATGCACATATTACATGG + Intergenic
1012701997 6:102470070-102470092 TGGCAAATAAGCATATAAAAAGG - Intergenic
1012744861 6:103073236-103073258 GGGACTATACAAATATAACAGGG + Intergenic
1013384220 6:109608520-109608542 TGGCCAATATACATATAAAAAGG - Intronic
1014143740 6:117972597-117972619 GAGCAAAGACACATCTTACATGG + Intronic
1014346975 6:120283327-120283349 GGGGAAAGACACATATCACATGG + Intergenic
1014407667 6:121070402-121070424 GAGCAAATGCACATCTTACATGG - Intergenic
1016151644 6:140748409-140748431 GAGCAAAGGCACATATTACATGG - Intergenic
1016166843 6:140956323-140956345 GGGTAAATATTCATATACCATGG + Intergenic
1017667535 6:156735752-156735774 GGGAAAAAACTCATCTAACATGG - Intergenic
1017729055 6:157298789-157298811 TGCCAACTACATATATAACAAGG + Intronic
1019088609 6:169504446-169504468 GGGCAAAGTCACATCTTACATGG - Intronic
1021207423 7:17800791-17800813 TGGCCAATAAACATATAAAAAGG + Intronic
1022006194 7:26267733-26267755 GGGTAAAGTAACATATAACAAGG + Intergenic
1022639543 7:32168832-32168854 GAGCAATTACACATATCACCTGG + Intronic
1024391226 7:48814651-48814673 GGGCAAATAAACAAAATACATGG - Intergenic
1024413637 7:49078040-49078062 GAGCAAAGACACATCTTACATGG + Intergenic
1024984590 7:55183954-55183976 GGTCACATACACATTTCACACGG - Intronic
1027650213 7:80857169-80857191 ACACATATACACATATAACAAGG - Intronic
1028036254 7:85988030-85988052 AGGCAAACACACATACAACTAGG + Intergenic
1028064009 7:86359133-86359155 TGGCAAATAAACATATGAAAAGG + Intergenic
1028599421 7:92585450-92585472 GTGCAAATATACACATATCAAGG + Intronic
1030062144 7:105630954-105630976 AGGCACATGCAGATATAACAAGG - Intronic
1030733969 7:113022105-113022127 TGGCAAACAGACATATAAAAAGG - Intergenic
1032644070 7:133801869-133801891 GGCAAAATGCACATATAAAAAGG - Intronic
1032685203 7:134225539-134225561 GTGGAAATACAAATGTAACAAGG + Intronic
1032876499 7:136044128-136044150 GAGCAAATGCACATCTTACATGG - Intergenic
1033500362 7:141942804-141942826 TGGCAAATAGAAATATAAAAAGG + Intronic
1034577765 7:152015796-152015818 GGGGAAATGCACAGATGACAGGG - Intronic
1037034728 8:14152311-14152333 TGGCAAATAAACACATAAAAAGG + Intronic
1037381836 8:18293570-18293592 GGGCAAAGGCACATCTTACATGG + Intergenic
1037475995 8:19258248-19258270 GGGCAAAGTCACATCTTACATGG + Intergenic
1038094527 8:24293101-24293123 GAGCAAAGACACATCTTACATGG + Intergenic
1039720611 8:40160319-40160341 GGTCAAATATACATGTATCAAGG - Intergenic
1040972032 8:53145917-53145939 TGGCAATAGCACATATAACATGG + Intergenic
1041569168 8:59317141-59317163 GAGAAAATACATATATAGCACGG - Intergenic
1044005937 8:86937144-86937166 GGGCAAAGTCACATCTTACATGG + Intronic
1045509414 8:102803024-102803046 TGGCAAACAGACATATAAAAAGG + Intergenic
1046147466 8:110179908-110179930 TGGCAAATAGGCATATAAAAAGG - Intergenic
1046431236 8:114131573-114131595 GGGCAAAGACACATCTTACATGG + Intergenic
1046576360 8:116034886-116034908 GAGCAAAGTCACATATTACATGG + Intergenic
1046954800 8:120052243-120052265 AGGCAAACAGACATGTAACAGGG - Intergenic
1048264236 8:132971409-132971431 GGGAAAATAAAGAAATAACAGGG - Intronic
1050766380 9:9140324-9140346 GGGTATGTACACATATACCAAGG - Intronic
1050798403 9:9577251-9577273 AGGCAAATATACATTTAAAAAGG + Intronic
1052734270 9:32324145-32324167 GGGCACATATACATATATAATGG + Intergenic
1058307863 9:103465113-103465135 GAGCAAAGACACATCTTACATGG + Intergenic
1060763822 9:126278256-126278278 AGGCCAATACACATATGATAAGG + Intergenic
1061599854 9:131660930-131660952 TGGCCAATAAACATATAACAAGG + Intronic
1061910224 9:133718514-133718536 ATGCATATACACATAGAACAGGG + Intronic
1203652984 Un_KI270751v1:146142-146164 TTGCAAACACACATATAAAAGGG - Intergenic
1186642748 X:11473359-11473381 GGTCACATACACAGGTAACATGG - Intronic
1186670788 X:11765271-11765293 GCTCTAAGACACATATAACAGGG + Intronic
1187626203 X:21116972-21116994 GAGCAAAGACACATCTTACATGG + Intergenic
1188192584 X:27190516-27190538 ATTCAAATACACATATATCAGGG - Intergenic
1188543863 X:31280176-31280198 GAACAAATACACATATAACCTGG + Intronic
1188749793 X:33890969-33890991 TGCAAAATACACATGTAACATGG - Intergenic
1188800143 X:34519255-34519277 GGGCATATATACCTAGAACATGG + Intergenic
1188977575 X:36693426-36693448 TGGCAAACACACATATGAAAAGG + Intergenic
1190822581 X:53987400-53987422 GGCCAAAAACAAATATAAAATGG + Intronic
1191801203 X:65081973-65081995 TGGAAACTACACAAATAACATGG + Intergenic
1193439222 X:81517863-81517885 TGGCAAACAGGCATATAACAAGG + Intergenic
1193464888 X:81836243-81836265 GGGAAAATACAGTTATTACATGG + Intergenic
1193982070 X:88193910-88193932 GGGCAAACAAACATATGAAATGG + Intergenic
1194443048 X:93955911-93955933 GAGCAAAGTCACATCTAACAAGG - Intergenic
1194586314 X:95738685-95738707 TGGCAAATAGGCATATAAAAAGG + Intergenic
1194929794 X:99872857-99872879 TGGCAAATAGACATATGAAAAGG + Intergenic
1195134744 X:101893832-101893854 GGGCACAGACACAAAAAACAGGG + Intronic
1195236580 X:102905394-102905416 AGGCAAAAACACATCTTACATGG + Intergenic
1195730463 X:107961546-107961568 TGGCAAATAGACATATGAAAAGG - Intergenic
1195768497 X:108322246-108322268 AGGCAAATGCACATTAAACATGG - Intronic
1196476028 X:116088155-116088177 TGGCAAATAAACATAGAAAATGG - Intergenic
1196823941 X:119726143-119726165 AGGTAAATATACATATAAGAAGG + Intergenic
1197028142 X:121780668-121780690 TGGCAAACAGACATATAAAAAGG - Intergenic
1197086598 X:122483783-122483805 TGCCAAATACACATATGGCAAGG + Intergenic
1197480474 X:126978443-126978465 GGGTAAATGCACATAAAAGAAGG - Intergenic
1199313832 X:146353474-146353496 GAGCAAATACCCATATTTCAGGG + Intergenic
1199525879 X:148791291-148791313 GAGCAAAGTCACATCTAACATGG + Intronic
1199580640 X:149356937-149356959 GAGCAAAGACACATCTTACATGG - Intergenic
1200903059 Y:8452469-8452491 GAGCAAACACACCTACAACATGG - Intergenic
1201336908 Y:12891452-12891474 GGGGAAATGCAAATATAAAAGGG + Intergenic
1202254736 Y:22909207-22909229 GAGCAAACACACCTACAACATGG - Intergenic
1202260606 Y:22966537-22966559 GGGCAATTTTACATATTACAGGG + Intergenic
1202407727 Y:24542956-24542978 GAGCAAACACACCTACAACATGG - Intergenic
1202413593 Y:24600278-24600300 GGGCAATTTTACATATTACAGGG + Intergenic
1202457192 Y:25069808-25069830 GGGCAATTTTACATATTACAGGG - Intergenic
1202463054 Y:25127125-25127147 GAGCAAACACACCTACAACATGG + Intergenic