ID: 944509817

View in Genome Browser
Species Human (GRCh38)
Location 2:200453548-200453570
Sequence TTTTCCTGCCTTGCAACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944509816_944509817 -3 Left 944509816 2:200453528-200453550 CCTTAAATGTATAAAGGAAGTTT 0: 1
1: 0
2: 4
3: 38
4: 416
Right 944509817 2:200453548-200453570 TTTTCCTGCCTTGCAACTAGTGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944509817 Original CRISPR TTTTCCTGCCTTGCAACTAG TGG Intronic
904398506 1:30240068-30240090 TATGCCTGCCTTGCAATTTGTGG + Intergenic
905611360 1:39354759-39354781 TTTTCAAGCCTAGCATCTAGAGG - Intronic
908776294 1:67644097-67644119 TATTCTTGTCTTGAAACTAGAGG + Intergenic
909017505 1:70395623-70395645 TTTTCTTGAACTGCAACTAGAGG + Intergenic
911060253 1:93741234-93741256 TTATACTGGCTTGCAACTTGGGG + Intronic
912109726 1:106326544-106326566 TTTTCCTTTCTTGAGACTAGAGG - Intergenic
919166966 1:193907673-193907695 TTTTCCTACCTTTCCACTAGTGG + Intergenic
919536450 1:198793654-198793676 TTTTCCTGCCTTGCTATGATTGG + Intergenic
921818928 1:219594482-219594504 TTTTCCTGCATTGCATCCTGAGG + Intergenic
922057427 1:222054816-222054838 CTTTCCTGCATAGCAACTATGGG - Intergenic
923797147 1:237168540-237168562 TTTTCCTGCCTTTCGCCGAGAGG + Intronic
924460747 1:244256392-244256414 TTTTCCTTCATTCCAAATAGAGG - Intergenic
924623636 1:245683406-245683428 TTTTCCTGCCTTGCTTTTAAAGG - Intronic
1064741274 10:18437531-18437553 TTTTCCAGCCTGGCAACAAAAGG - Intronic
1071578030 10:86744337-86744359 TTTTTCTTCCTTGAAACTTGAGG - Intergenic
1071825666 10:89322889-89322911 GTTGCCTGCCTGGCAACCAGTGG - Intronic
1072718013 10:97764530-97764552 CTTTGCTGTCTTGCACCTAGGGG + Intergenic
1073624646 10:105084654-105084676 TTGTGCTGCCTTGTTACTAGGGG + Intronic
1073677943 10:105670909-105670931 TTCTTCTGCCTTGCAGCTGGTGG + Intergenic
1075262902 10:120978357-120978379 TTTTGCTGCCTTTCCACTGGTGG + Intergenic
1076030915 10:127157304-127157326 TTTTTCTGACTTGCAAACAGAGG - Intronic
1079769570 11:24443100-24443122 ATTTTCTGCTTTGCAAATAGTGG + Intergenic
1080434229 11:32224866-32224888 TCTCCCTGCCGTGCAAATAGTGG - Intergenic
1082779207 11:57273317-57273339 TTTTCCTCCCCTTCAACTTGGGG + Intergenic
1087331185 11:96782664-96782686 TTTTCCTGACTTGGGACAAGAGG + Intergenic
1090648237 11:128783874-128783896 TTTTCCTTCCTTCCAAAAAGTGG - Intronic
1091356950 11:134944496-134944518 TTTTCCTGCTTGGCACCAAGAGG - Intergenic
1093572466 12:20682703-20682725 TTTTCTTTCCTTGCAATTAAGGG + Exonic
1094605523 12:31945699-31945721 TTTTCCTGCCTCAAATCTAGAGG + Intergenic
1096378696 12:51136593-51136615 TGTTCCTGCTTTGAAACTGGAGG - Intronic
1096471423 12:51879387-51879409 TTTTCCTGCCAGGCATGTAGAGG - Intergenic
1097378137 12:58862065-58862087 TTTTCCTCCTATGTAACTAGTGG + Intergenic
1098662332 12:73111600-73111622 TTTTCCTGCCTTGAAGCTCCTGG - Intergenic
1099532563 12:83802774-83802796 TTTTCCTGCCTTTCAAATTTAGG + Intergenic
1099895472 12:88641163-88641185 TTTTCCTGCCTAGCATCTATTGG - Intergenic
1102957785 12:117070532-117070554 TCTTCCTGCCCTGCTACTGGGGG - Intronic
1110561278 13:76912883-76912905 TGTTCCTGCATTACAAGTAGAGG - Intergenic
1113213255 13:108007354-108007376 TTTTAATCCCTGGCAACTAGCGG + Intergenic
1115919949 14:38361411-38361433 TTTGCCTCCTTTGCAAGTAGAGG + Intergenic
1116730853 14:48620724-48620746 TTTCCCTGCCCTGTAACTATTGG - Intergenic
1121906532 14:97751193-97751215 TTTTCCTGCTTTTCAAGTAAGGG - Exonic
1126527989 15:49678993-49679015 TTGTCCTGTCATGAAACTAGGGG - Intergenic
1128136992 15:65271132-65271154 GTTGCCTGCCTTCCCACTAGAGG - Intronic
1128343478 15:66838852-66838874 TTTCCATGCTTTGCCACTAGGGG + Intergenic
1128462585 15:67882500-67882522 ATTTCCTGCCTTACAAGCAGGGG - Intergenic
1132627201 16:897123-897145 TGTTCCCGCCTTGCAACGTGTGG + Intronic
1133574935 16:7079678-7079700 TTTTCCTGCATGGCAAATGGAGG + Intronic
1134209616 16:12265171-12265193 ATTTCCTGCCCTGAAACAAGTGG - Intronic
1135104188 16:19633079-19633101 TTTTCCTGCTTAGAAACGAGAGG + Exonic
1135742923 16:24992122-24992144 TTTGCCTGCCATGGAACTCGGGG + Intronic
1141137762 16:81477817-81477839 TTTGCCTGCCTTCCAGTTAGTGG + Intronic
1144093859 17:11882199-11882221 TTTTCCTGCCTTGGAGGCAGCGG + Intronic
1145841927 17:28002434-28002456 TTTTCCTGCTTTTGAACTAGAGG - Intergenic
1146411904 17:32593194-32593216 TTTTCCAGCCTTGCCACCAGGGG - Intronic
1147609415 17:41792889-41792911 TTTTCCTGCCTTGTGTCCAGGGG + Intergenic
1148663974 17:49361522-49361544 TTCTCCTGCCCTGCAGCTGGTGG - Intronic
1149541123 17:57468936-57468958 TTTTCCTCCCTTGAAAGCAGAGG + Intronic
1150149126 17:62794470-62794492 TTTTTCTGCCCTGTAAGTAGAGG + Intronic
1153027266 18:683237-683259 TTTTCCTACCTTGGAAATGGTGG + Exonic
1153124385 18:1772773-1772795 TTTTCCTGCCATGTAAATTGAGG + Intergenic
1154497717 18:14974799-14974821 TTTTCCTGCTTGGCACCAAGAGG + Intergenic
1155630103 18:27883189-27883211 CTTGCCTGCCCTGCAACAAGAGG - Intergenic
1156350777 18:36299083-36299105 TTGACCTGCTTTGCAAGTAGAGG + Intronic
1157029094 18:43882718-43882740 TTTTTCTGCCTTGAAATTTGAGG - Intergenic
1159291077 18:66420916-66420938 TTTTACTGCCTTTCCCCTAGGGG + Intergenic
1159444234 18:68521007-68521029 TTTTCCCGCATTGAAAGTAGTGG - Intergenic
1161933874 19:7359047-7359069 TCTTCCTGCCTGGCAACTGAGGG - Intronic
1162282501 19:9710382-9710404 TTTGCCTTCCTTGCTACTGGAGG - Intergenic
1162940021 19:14003692-14003714 TTTCCCTTCCTTTCATCTAGGGG - Intronic
1164589264 19:29497366-29497388 TTTTCCTTCCTAGCAATTAGTGG - Intergenic
926046046 2:9710435-9710457 GTTACCTGCCTTGCAACCTGGGG - Intergenic
926216918 2:10911656-10911678 TTTTCCTGCCCAGCAACAGGCGG + Intergenic
927050059 2:19319448-19319470 TCTTCCTGCTTTGAAACTGGAGG - Intergenic
927677033 2:25113873-25113895 TTTCCCTGTCTTTCAAATAGGGG - Intronic
928130196 2:28643431-28643453 TTTTTCTGCCTTTGAAATAGTGG - Exonic
928370085 2:30734366-30734388 TGTGCCAGCCTTGCTACTAGGGG + Intronic
938804884 2:134796821-134796843 TTCCCCTGCCTTGCAACTGCAGG - Intergenic
942587882 2:177504539-177504561 ATTTCCTGACTTGCCACTATAGG - Intronic
944509817 2:200453548-200453570 TTTTCCTGCCTTGCAACTAGTGG + Intronic
945266293 2:207894508-207894530 TATTCCTGCCTTCCAACCAGTGG + Intronic
946869815 2:224075316-224075338 ATGTCATGTCTTGCAACTAGTGG - Intergenic
947135310 2:226971614-226971636 TTTTTTTGCCTTGCAAATATGGG + Intronic
1170168347 20:13384271-13384293 TTTTTCTGCATTGCCACTTGTGG + Intergenic
1172784890 20:37461626-37461648 TTTTCCTGAGTTGCACATAGAGG + Intergenic
1177745792 21:25211579-25211601 CTTTCCTGGCTTGCTACTAAAGG + Intergenic
1178807542 21:35851941-35851963 TTCTCCTGCTTTGTAACCAGTGG - Intronic
949452376 3:4200485-4200507 TTTTCCAGCCTTTGAACTATGGG + Intronic
949501144 3:4681047-4681069 TTTCCCTGCCCAGGAACTAGTGG + Intronic
949985073 3:9534107-9534129 TTCTCCTGCCTCCCAAATAGCGG - Intronic
953198394 3:40755014-40755036 TTTCCTTGCCTTCCAACTAAAGG - Intergenic
959308438 3:104698321-104698343 TTTTCCTGCAATGAAACAAGTGG - Intergenic
960001773 3:112739848-112739870 TTTTCCTGTCTTTGAACTTGAGG - Intergenic
962214071 3:133504538-133504560 TTCTCCTGGCTTGCAGATAGTGG - Intergenic
962349728 3:134647952-134647974 TTGGCCTCCCTTGCAGCTAGAGG + Intronic
964437078 3:156664860-156664882 ATTTCCTGCCTTTCAACTTGAGG + Intergenic
964769278 3:160207713-160207735 TTTTCCTGCCTAGAAATTAGCGG + Intergenic
964935937 3:162087441-162087463 TTTTCCTGAATTGCAACTATTGG + Intergenic
967918035 3:194593469-194593491 AATTCCTGCCTTGCAAATATGGG + Intronic
969782415 4:9418422-9418444 ATTTCCAGTCTTTCAACTAGTGG - Intergenic
970991083 4:22214063-22214085 TTTTCATCCCTTGTGACTAGGGG - Intergenic
977152429 4:93529574-93529596 TTATGTTGCCTTCCAACTAGAGG + Intronic
977387860 4:96367296-96367318 TTTTCCTCCCTTGAAATTAATGG - Intergenic
978434043 4:108664256-108664278 GTATCCTTCCTTGTAACTAGTGG - Intronic
979281158 4:118869621-118869643 TTTTCCTGCCCTTCAAGTAGAGG - Intronic
979612132 4:122700446-122700468 CTTTCCTGCGTTGCAAGTAAGGG + Intergenic
985289053 4:188368433-188368455 TTTTCTTGCCTTGAAATTTGAGG - Intergenic
986158422 5:5200006-5200028 TTTGCCTGCCTAGCATATAGGGG + Intronic
986736110 5:10668513-10668535 TTTACGTGACTTGCAATTAGAGG - Intergenic
986921511 5:12689157-12689179 ATTTCCTGCCTTGCCACTCTAGG + Intergenic
987434975 5:17883586-17883608 TTTTCCTGCGTAGAATCTAGGGG - Intergenic
990061094 5:51649873-51649895 TTATCCTGCCTGGCAACAGGTGG + Intergenic
990516756 5:56537351-56537373 TTTTCCTGCCCTCCAACTTCTGG - Intronic
991301518 5:65133326-65133348 GTTTCCTGCCTTGCAACCAAGGG - Intergenic
994817967 5:104608924-104608946 TTGTCTTGCATTGCAACGAGGGG - Intergenic
997229331 5:132231284-132231306 TCTTCCTGCCTTGCAGGAAGTGG + Intronic
997432823 5:133852815-133852837 TTGGCCTGCCTTGCTAGTAGGGG - Intergenic
998214308 5:140225780-140225802 TTTTCCTGCCGTGAATCTACTGG + Intronic
998776523 5:145609768-145609790 ATTTCCTGCCTGGCTACCAGTGG + Intronic
1000145308 5:158447976-158447998 TTTTTTGTCCTTGCAACTAGAGG + Intergenic
1001722591 5:173868763-173868785 TTTGTGTGCCTTGCAACTGGGGG - Intergenic
1001736686 5:174010435-174010457 TTTTCCTGCCTTCTGGCTAGTGG + Intergenic
1007111515 6:39315738-39315760 TTTGCTTGCCTAGCAACTAAAGG + Intronic
1007739967 6:44004274-44004296 TTTTTCTGCCATGAGACTAGAGG + Exonic
1009922367 6:70078476-70078498 TTCTCCTGCCTTGAAGCAAGGGG + Intronic
1010267795 6:73886438-73886460 TTCTCCTGCCTTTCAGCTGGGGG - Intergenic
1010813611 6:80328715-80328737 TTTTGCTACCTAGCAACTTGGGG - Intronic
1014767740 6:125426181-125426203 TTTGCCTGACTTGAAACCAGTGG + Intergenic
1017404538 6:154104133-154104155 TATTCCTGCCTAGCTATTAGGGG + Intronic
1017511821 6:155121425-155121447 TTTTCCTCATTTGCAACTTGAGG - Intronic
1022893091 7:34720748-34720770 TTTTCCTGACATGCATCTGGAGG - Intronic
1023597181 7:41843145-41843167 TTTTGATGCCTTGCTAGTAGGGG + Intergenic
1024894805 7:54245744-54245766 TTTCCCTCCCTTTCAACTAGTGG + Intergenic
1028856826 7:95602548-95602570 ATTTCATTCCTTGCAACTAACGG - Intergenic
1033512457 7:142072726-142072748 AATTCCTGGCTTGCAAATAGAGG - Intronic
1034221988 7:149453999-149454021 TTCTCCTTGCTTGCAACTATTGG + Intronic
1035139526 7:156744223-156744245 TATTCCTCCCTTACAACTATGGG + Intronic
1036836647 8:12075706-12075728 ATTTCCAGTCTTTCAACTAGTGG + Intergenic
1036858490 8:12322273-12322295 ATTTCCAGTCTTTCAACTAGTGG + Intergenic
1039052434 8:33507117-33507139 TTTTCCTGCCTTGGAAAGTGAGG - Intronic
1043301360 8:78738002-78738024 TTTTCCTACTTTTCTACTAGTGG - Intronic
1045578638 8:103453742-103453764 TCTACCTCCCTTGCACCTAGGGG + Intergenic
1046029999 8:108772350-108772372 TTTTCCTGACTTGCAAAGATGGG - Intronic
1046095315 8:109552159-109552181 CTATCCTTCCTTGCAGCTAGGGG - Intronic
1047720756 8:127637042-127637064 TTTTCCTGCCTTGAAATTCATGG + Intergenic
1048184260 8:132225070-132225092 TTTTCCTGATTTGCAAACAGGGG - Intronic
1048290204 8:133175399-133175421 TTTTCCAGCCATGGAACTTGGGG + Intergenic
1051093594 9:13438857-13438879 TAATACTGCCTTGCAACTCGCGG + Intergenic
1052887539 9:33664820-33664842 TATTCCTGTCCTCCAACTAGTGG + Intergenic
1053340919 9:37330034-37330056 TTTATCTGCCTCCCAACTAGAGG + Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1055250404 9:74296655-74296677 TTTTCTTTCCTTGCTACTTGAGG - Intergenic
1057200015 9:93134768-93134790 TTTTCCTGCCTGGGAAATGGGGG + Intergenic
1057280005 9:93702362-93702384 CTTGCCTGCCTTGCAGCAAGTGG - Intergenic
1059612047 9:115909030-115909052 GTCTTCTGCCTTGAAACTAGGGG + Intergenic
1186965933 X:14786092-14786114 TTGTCCTGCCTTGAAGCAAGGGG + Intergenic
1187164709 X:16794232-16794254 TTTTGCTCACTTTCAACTAGGGG - Intronic
1188868856 X:35348802-35348824 TTTTTCTGCCTTGTAACTCAAGG + Intergenic
1189078124 X:37939756-37939778 TCTACCTGCCTTGCCTCTAGGGG - Intronic
1191217830 X:57951743-57951765 ATTGCCTGCCTGGCTACTAGTGG + Intergenic
1194234671 X:91367451-91367473 TCTTCCTGGCTTGCAGATAGTGG - Intergenic
1196017230 X:110952860-110952882 TTTTGCTGCCTTGAAAAAAGTGG + Intronic
1199765303 X:150936928-150936950 TTTTCCTGAGTGCCAACTAGGGG + Intergenic