ID: 944511456

View in Genome Browser
Species Human (GRCh38)
Location 2:200470104-200470126
Sequence ACCTCACGTTAGCCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944511456 Original CRISPR ACCTCACGTTAGCCCCCTGG GGG (reversed) Intronic
902606640 1:17572878-17572900 ACCTCAGCTTGGCCCCCTGGAGG + Intronic
903653264 1:24933706-24933728 ACCTCACTTTCGCCCCCAGCCGG + Intronic
905337040 1:37251936-37251958 CCCTTACGTTAGCCTCCTGGAGG + Intergenic
906323634 1:44831210-44831232 AGCTCACTGTAGCACCCTGGTGG - Intronic
907113578 1:51949480-51949502 ACCGCACCTTCGGCCCCTGGAGG + Intronic
912840971 1:113038742-113038764 ACCTCAGGTGATCCGCCTGGTGG - Intergenic
916470663 1:165119272-165119294 ACTTCTCATTAGCCCCCTGCCGG + Intergenic
1063172674 10:3523385-3523407 ACCTCACCCCAGCCCCCAGGTGG - Intergenic
1066486389 10:35849356-35849378 AACTCAAGTTAGCCCTCTGGGGG - Intergenic
1067307363 10:45076905-45076927 AACTCAAGTTAGCCCTCTGGGGG - Intergenic
1070057489 10:72949743-72949765 ACCTCAGGTGATCCCCCTGCTGG - Intronic
1078843341 11:15099400-15099422 ACATCACATTAGCCACTTGGAGG - Intergenic
1083429382 11:62606056-62606078 CCCTCACCTCAGCCTCCTGGAGG + Exonic
1087462925 11:98467884-98467906 ACCTCAAGTTAGTCCACTTGTGG + Intergenic
1089496192 11:118909766-118909788 ACCCCCCTTTAGCCCACTGGTGG + Intronic
1094753465 12:33439674-33439696 GCCCCACGTTGGCCCCATGGCGG + Exonic
1103068541 12:117920594-117920616 ACCTCACAATAGGCCCATGGGGG + Intronic
1104766216 12:131332048-131332070 ACATGACGTTAGCCCACTGTTGG - Intergenic
1104813184 12:131630485-131630507 ACATGACGTTAGCCCACTGTTGG + Intergenic
1113021366 13:105890799-105890821 ATCTCACCTTAGGCCTCTGGGGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1128323486 15:66707983-66708005 GCCTCTGGTTAGCCCCCAGGGGG - Intronic
1133021119 16:2967384-2967406 AGCTCACGTTGGCCCCGTCGAGG - Exonic
1133448703 16:5885294-5885316 ATGTCACGTTAGACTCCTGGAGG + Intergenic
1142306645 16:89289684-89289706 ACCTCACTCCAGGCCCCTGGAGG - Intronic
1144779576 17:17801060-17801082 ACCTCACTTTTGCGCTCTGGAGG + Intronic
1146395550 17:32462504-32462526 TCCTCACTGGAGCCCCCTGGTGG - Intronic
1151219646 17:72603013-72603035 ACTTCCAGTTAACCCCCTGGAGG - Intergenic
1151801842 17:76383670-76383692 ACCTCGAGTTAGATCCCTGGGGG - Intronic
1152256103 17:79240559-79240581 ACCTCACGTCAGCCCCATTAGGG + Intronic
1152941285 17:83173993-83174015 CCCTCACTTTTGGCCCCTGGAGG + Intergenic
1156512798 18:37655309-37655331 ACCTCAGGTCAGCCTCCTGGAGG - Intergenic
1168025334 19:53639651-53639673 ACTTCTGGTTAGCTCCCTGGCGG + Intergenic
925284833 2:2709131-2709153 CCCTCACGGAAGCCCCGTGGAGG + Intergenic
928125892 2:28615593-28615615 GGCTCACGTTAGCCCAGTGGAGG + Intronic
929304273 2:40342595-40342617 ACAGCATGTTGGCCCCCTGGGGG - Intronic
934954261 2:98603952-98603974 ACCTAACGTTAACTCACTGGAGG + Intronic
942762028 2:179411071-179411093 ACCACACTATTGCCCCCTGGTGG - Intergenic
943622050 2:190159297-190159319 AACTCAAGTGAGCCTCCTGGGGG - Intronic
944511456 2:200470104-200470126 ACCTCACGTTAGCCCCCTGGGGG - Intronic
1170621670 20:18001588-18001610 AGCCCAGGTTAGCCCTCTGGAGG - Intronic
1172181297 20:33005257-33005279 AATTCACTTTTGCCCCCTGGTGG + Intergenic
1172951004 20:38723614-38723636 ACCTCTCGTCAGCCTCCTAGCGG - Intergenic
1175159250 20:56995761-56995783 ACCTCACCTGTGCCACCTGGTGG + Intergenic
1176140296 20:63541981-63542003 ACCTGACGCCAGCCCCCTGTTGG + Intronic
1176659408 21:9620068-9620090 CCCGCACATTAGCCACCTGGCGG - Intergenic
1183169954 22:36180457-36180479 ACCTCATGGCTGCCCCCTGGTGG + Intergenic
1184152302 22:42646236-42646258 ACCTCACCCCAGCCACCTGGGGG + Intronic
1184339299 22:43877257-43877279 GCCTCACATCAGCCCCCGGGTGG - Intergenic
1184834429 22:47012728-47012750 ACCACACTTCAGCCCCCTGCAGG + Intronic
1185138948 22:49089582-49089604 ACCTGTGGTTAGCACCCTGGGGG - Intergenic
951611666 3:24496760-24496782 ACCCCCCGTTAGCCACCAGGGGG - Intergenic
953094028 3:39757310-39757332 ACCTCACCTTAATCCCATGGTGG + Intergenic
954291129 3:49650696-49650718 ACCTCACAGCAGCCCCCTGTAGG + Exonic
956311484 3:67885448-67885470 ACCTCACTTTATCACCCAGGTGG - Intergenic
964819929 3:160757403-160757425 ACCTCACCCTTGCGCCCTGGCGG + Intronic
988508361 5:31843774-31843796 ACCTCACTTTAACCCCAAGGAGG - Intronic
1001137214 5:169112569-169112591 ACCTCATTTTTGCCCCATGGTGG + Intronic
1002186045 5:177455301-177455323 ACCACACCGTAGCCGCCTGGAGG + Exonic
1006896408 6:37473996-37474018 ACCTCACTTTAGACTCCAGGGGG - Intronic
1010553329 6:77249988-77250010 ACCTCATGGTTGACCCCTGGAGG - Intergenic
1017905975 6:158757743-158757765 AACACACTGTAGCCCCCTGGGGG - Intronic
1025032425 7:55568910-55568932 ACCTCACTTCAGCCAGCTGGCGG + Intronic
1029686330 7:102150631-102150653 GCCACGCGTTAGCCCCCAGGAGG + Intronic
1032501630 7:132404199-132404221 GCCTCACATCAGCCTCCTGGAGG - Intronic
1034222325 7:149455946-149455968 ACCTTACGTCAGGCCCCTGCTGG - Exonic
1039811582 8:41053960-41053982 ACGTCATGTTAGTCCCCTTGGGG - Intergenic
1041781841 8:61585569-61585591 ATCTCTCGTGTGCCCCCTGGTGG + Intronic
1056430923 9:86526912-86526934 ACCTCAGGGTTGCCCCCTGAAGG - Intergenic
1060878451 9:127100552-127100574 AGCTCACCTTGGCTCCCTGGGGG + Intronic
1062045989 9:134424788-134424810 TCCTGACCTGAGCCCCCTGGAGG - Intronic
1203636970 Un_KI270750v1:121911-121933 CCCGCACATTAGCCACCTGGTGG - Intergenic
1193562274 X:83032930-83032952 AGCACAAGATAGCCCCCTGGAGG + Intergenic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic