ID: 944511736

View in Genome Browser
Species Human (GRCh38)
Location 2:200472254-200472276
Sequence GCGGGCCTGGCCCTGTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944511736 Original CRISPR GCGGGCCTGGCCCTGTGTTT GGG Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900966580 1:5962861-5962883 GCAGCCCAGGCCCTGTGTTTCGG - Intronic
901696694 1:11012931-11012953 GCGGGCCCGGCCCCCCGTTTCGG - Intronic
901875675 1:12165834-12165856 GCAGGGCTGGCCCTGTATTAGGG + Intergenic
903890829 1:26569388-26569410 GGGGGCCTGGCCTTGTGCTGTGG + Intronic
904447948 1:30589701-30589723 ACGTGCCTGGCCCTGTGCTGTGG - Intergenic
906189267 1:43885459-43885481 GCGGGCTGGGGCCTGTCTTTTGG + Intronic
906191016 1:43899498-43899520 CAGAGCCTGGGCCTGTGTTTGGG - Intronic
907484444 1:54767467-54767489 GAGGGCCTGGCCCGGTGTTGGGG + Intergenic
909643079 1:77888492-77888514 GGGGAACTGGCCTTGTGTTTTGG + Intronic
912511886 1:110195325-110195347 ACGGGCCAGGCCCTGTGCTGGGG + Intronic
920021309 1:202958391-202958413 GCGGGCGCGGGCCTGTGATTGGG - Intronic
920705528 1:208247999-208248021 GTGTGCCTGGACCTGTGCTTGGG + Intergenic
921290475 1:213652233-213652255 ACGTGCCTGGCACTGTGTTAAGG + Intergenic
921932053 1:220762709-220762731 GCAGCCCTGTCCCTGTGTATGGG + Intronic
1068946910 10:62738814-62738836 GCCTGCCTGGCCCTGAGGTTGGG - Intergenic
1071328337 10:84538178-84538200 GAGGGCCTGGCCCCTTGGTTTGG + Intergenic
1073063918 10:100747580-100747602 CCCGGCTTGGACCTGTGTTTAGG + Intronic
1075682187 10:124341051-124341073 GCGGGGCTGGCACTGGGATTTGG - Intergenic
1075783242 10:125030899-125030921 GCTGCCCTGGCCCTTTGTGTTGG - Intronic
1076215564 10:128690929-128690951 GTGACCCTGGCCCTGTCTTTGGG + Intergenic
1076833329 10:133007716-133007738 GCGGGGGTGGGGCTGTGTTTGGG - Intergenic
1077319460 11:1934768-1934790 AGGGGCCTGGCCCTGCCTTTGGG + Intronic
1077532690 11:3104586-3104608 GCGGGCCTGGACCTGGGCTGCGG - Intronic
1081812480 11:45921883-45921905 GCGTGCCAGGCCCTGTGCTAAGG - Intronic
1083623095 11:64058604-64058626 GCGGGCACGGCCCTGTAATTGGG + Intronic
1083720335 11:64600658-64600680 GCGGGCCTGGCCCGGCGTGCAGG + Intronic
1084170958 11:67400962-67400984 GCAGTCCTGGCCCTGGGTTCAGG - Intronic
1084963163 11:72727756-72727778 GGGGGCCTGGCCCTGGAATTGGG + Intronic
1085128432 11:74017801-74017823 GAGGGCCTGGCCCTCTTCTTTGG + Intronic
1085205601 11:74730542-74730564 GAGGGCAGGGCACTGTGTTTTGG - Intronic
1085697884 11:78721326-78721348 GCTTGTCTGGCCCTGTGTGTGGG + Intronic
1089836114 11:121372195-121372217 ACAGGCCTGGCCCTGTGTCTTGG + Intergenic
1091632250 12:2170953-2170975 GCTGGTCTGTCCCTGTGCTTGGG + Intronic
1091837755 12:3597672-3597694 CAGGGCCTGGCCCAGAGTTTGGG + Intergenic
1092241300 12:6837903-6837925 GCCGGCCTGGGCCTGGGTTGGGG + Intronic
1098297283 12:69016966-69016988 CCGTGCCTGGCCCTGTTTTCTGG - Intergenic
1100239269 12:92694541-92694563 GCAGGCCTGGTTCTGTGTTGGGG + Intergenic
1103418854 12:120763634-120763656 GAGAGCCTGGCCCTGTGCTGTGG - Exonic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1103853741 12:123950315-123950337 GACGGCCTGGCCCTGTGCTCTGG - Intronic
1104950905 12:132439463-132439485 TGGGGCCTGGCCCAGTGTTGGGG + Intergenic
1107857940 13:44633920-44633942 CCGCGCCCGGCCCTGTTTTTTGG - Intergenic
1117094666 14:52284830-52284852 ACAGGCCTGGTCCTGTGTCTTGG - Intergenic
1118328202 14:64795693-64795715 GCTGCCCTGTCCCTGAGTTTGGG - Intronic
1118349063 14:64960633-64960655 GCGTGCCAGACCCTGTGTTATGG - Intronic
1118349153 14:64961160-64961182 GCTGGCCTGGCCCTGGGGATTGG - Intronic
1119223183 14:72925586-72925608 GCGGGCAGGGGCCTGTGTTACGG + Intergenic
1121634731 14:95446260-95446282 GCTGGCAAGGCCCTGAGTTTCGG + Intronic
1122893262 14:104742711-104742733 GCGGGCCTGGCCCTGCAGCTTGG - Intronic
1123936972 15:25198742-25198764 GGTGGCCTGACTCTGTGTTTGGG + Intergenic
1124090946 15:26599395-26599417 GCAGGCCAGGCCCTGAGTTTAGG - Intronic
1127207897 15:56739480-56739502 GAGAGCCTCTCCCTGTGTTTGGG + Intronic
1127875890 15:63111094-63111116 GTAGTCCTGACCCTGTGTTTGGG - Intergenic
1129389200 15:75212171-75212193 TGGGGCCTGTCCGTGTGTTTGGG + Intergenic
1130937835 15:88485249-88485271 GCGGGCCTGGCCTAGAGTCTAGG - Intergenic
1130969672 15:88722029-88722051 GTGGTCCTGGCCCTCTGTTCTGG - Intergenic
1132846967 16:2005138-2005160 CAGGGCCTTTCCCTGTGTTTGGG - Intronic
1132863509 16:2082861-2082883 GCGGGCCTTGCCCTGGCCTTTGG + Intronic
1135547707 16:23377054-23377076 GCTCTCCTGGCCCTGTGGTTAGG - Intronic
1139395296 16:66633976-66633998 GGTGGCCTGGGCCTGTGGTTGGG - Intronic
1139433226 16:66922340-66922362 GCAGGCCCGGCCCTCTGTGTGGG + Exonic
1141397864 16:83720772-83720794 GATGGACTGGCCCTGGGTTTGGG - Intronic
1141429880 16:83966002-83966024 GCGGGTCTGGCCGAGTGTTAGGG - Exonic
1141975900 16:87516256-87516278 GCAGCCCTGGGCCTTTGTTTAGG + Intergenic
1142591627 17:1008700-1008722 GGGGGCCTGGCCCTGAGCTGGGG + Intronic
1143409639 17:6701172-6701194 GCCAGCCTGGCCCTGTGCGTGGG + Intronic
1143853628 17:9832080-9832102 GTGGGCCAGGCCTTGTGTTAAGG - Intronic
1144974735 17:19133139-19133161 GCTGGCCCGGCCCTGGGTTGTGG + Intronic
1145058451 17:19717750-19717772 GTGGGGCTGTGCCTGTGTTTGGG - Intronic
1147168899 17:38606798-38606820 GCGGGCCTGGGTCTGGGTCTGGG - Intergenic
1147263616 17:39222780-39222802 GCAGGCCAGGCCCTGTCTCTGGG - Intronic
1147740975 17:42670773-42670795 GGGGGCGGGGCCATGTGTTTGGG + Intronic
1149447607 17:56725711-56725733 CTGTGCCTGGCCCTGTGTTAAGG + Intergenic
1150250970 17:63704310-63704332 GCTGGCCTGGGCCTGGGCTTCGG - Intronic
1150854922 17:68743092-68743114 GAGTGACTGACCCTGTGTTTTGG + Intergenic
1151565380 17:74894460-74894482 GAGGCCCTGGCCCTGGGTTCAGG - Intergenic
1152545568 17:80998561-80998583 GCGTGCCTGGCCTTGGGGTTGGG + Intronic
1152660734 17:81540792-81540814 GCGGGCCTGCCCCTGGGCTCTGG - Exonic
1152812380 17:82388150-82388172 CCGGTCCTCGCCCTGTGATTTGG - Intergenic
1153228829 18:2918191-2918213 GCTCTCCTGGCCCTGTGTTGAGG - Exonic
1153922835 18:9806493-9806515 GTGGGCCTGCCTCTGTGTTTAGG + Intronic
1155551743 18:26972508-26972530 GAGAGCATGGCCGTGTGTTTAGG + Intronic
1157359436 18:46964147-46964169 GCGGGTCAGGCCCGGTGTTTCGG + Exonic
1157361030 18:47023666-47023688 GCGGGTCAGGCCCGGTGTTTCGG + Exonic
1157362020 18:47029581-47029603 GCGGGTCAGGCCCGGTGTTTCGG + Exonic
1157362899 18:47035003-47035025 GTGGGCCAGGCCGGGTGTTTCGG + Exonic
1158552882 18:58451698-58451720 TCGTGCCTGGCCTTGTGTTGGGG - Intergenic
1160190049 18:76708340-76708362 CCGGGCCTGGCCCTCTGCTCGGG + Intergenic
1160216866 18:76940057-76940079 GCGACCCTAGCACTGTGTTTGGG + Intronic
1160243046 18:77136597-77136619 GAGGGCTTGGCCCTGGCTTTGGG + Intergenic
1160603204 18:80030214-80030236 ACAGGCCTGGTCCTGTGTCTTGG - Intronic
1161297569 19:3527472-3527494 GTGGGGCTGTCCCTGGGTTTAGG + Intronic
1162986989 19:14277312-14277334 CCGGGCCAGGCCCTGTGCCTGGG + Intergenic
1163257794 19:16168112-16168134 GCGTGCGTGGCCCTGGGGTTGGG - Intronic
1163519141 19:17781550-17781572 GCGGTCCTGGGCCTGGCTTTGGG + Intronic
1163618354 19:18342708-18342730 GGGGGCCTGGTCCTGAGTTCTGG - Intronic
1164954724 19:32372526-32372548 GAGGGCCTGGCCCTGGCTTCTGG + Intronic
1165209744 19:34224587-34224609 TCAGGCATGGCCCAGTGTTTAGG + Intronic
1165400688 19:35597865-35597887 GAGTGACTGGACCTGTGTTTGGG - Intergenic
1167571747 19:50292929-50292951 GGGGGTCTGGCCCGGTGATTGGG + Intronic
926045940 2:9709686-9709708 GCGGGCCTGGCCCTGGGTGAAGG - Intergenic
926668410 2:15550367-15550389 GTGTGCCTGGCACTGTATTTAGG - Intronic
929549612 2:42881034-42881056 GAGAGCCTGGTTCTGTGTTTAGG + Intergenic
932161792 2:69466829-69466851 CCGTGCCTGGCCCTGTGTGTAGG - Intronic
935225349 2:101047673-101047695 GTGGGGCTGGCCCTGTGATGGGG - Intronic
936091686 2:109505583-109505605 GCAGGCCTGGCACTGTGGTAAGG + Intergenic
941380642 2:164788155-164788177 GCTGGCCTGGGCTTGGGTTTTGG - Intronic
944511736 2:200472254-200472276 GCGGGCCTGGCCCTGTGTTTGGG + Intronic
947363493 2:229370197-229370219 GCAGGCCTGGCCCCCTGTTTGGG - Intronic
948731236 2:239965012-239965034 GCGTGGCTGGTCCTGTGTTTGGG - Intronic
1171444063 20:25191147-25191169 GAGTGCCTGGCCCTGCTTTTTGG - Intergenic
1172153992 20:32810853-32810875 AAGGGCCTGGCCCAGGGTTTGGG + Intergenic
1172176185 20:32973125-32973147 GAGGGACTGGCCCTGCGCTTCGG + Intergenic
1172873606 20:38150872-38150894 GTGTGCCCGGCCCTGTGTCTGGG - Intronic
1175296586 20:57913036-57913058 GCTGGCATGGCCCTGAGTGTTGG - Intergenic
1177228973 21:18294355-18294377 AGGGGCCTGGCCCTGGGTTGTGG - Exonic
1182704968 22:32271277-32271299 GCGGGCCTCGCCCTGTGTGGTGG - Intergenic
1183671069 22:39273185-39273207 GCGGGCCTAGCCCTGCCCTTGGG - Intergenic
1184076453 22:42182103-42182125 GGTGGCCTGGTCCTGGGTTTGGG - Intronic
1184284763 22:43464360-43464382 GGGGCCCTGGCCATGTCTTTGGG + Intronic
1184686528 22:46098863-46098885 CCAGGTCTGGCCCTGTTTTTTGG + Intronic
1184711222 22:46250512-46250534 GCGGGCCTGGCCCGCTGTCCTGG + Exonic
1184711373 22:46251058-46251080 GCGGGCCTTCACCTGTGCTTTGG + Intergenic
1184858584 22:47160479-47160501 GATGCCCTGGCCCTGTGCTTGGG - Intronic
1185260130 22:49856970-49856992 GCTGGCCTGGCCCTGGGGATGGG + Intronic
950170653 3:10837078-10837100 GAGGGGCTGGCCCTGGGGTTGGG + Intronic
960988026 3:123292993-123293015 GCTGGCCTGGCCCTGGGGATTGG - Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
968451903 4:679826-679848 GCCTGCCTGGCCCTGTGCTGGGG + Intronic
968672000 4:1856808-1856830 GCCGGCATGGCCCTGTCCTTCGG - Intergenic
968970615 4:3791653-3791675 GCGTGCCTGGCCCTGGCTGTTGG + Intergenic
972396496 4:38663648-38663670 GCGAGCCCGGCTGTGTGTTTTGG + Intergenic
974292001 4:59944826-59944848 GTAGGCCTGGCCCAGGGTTTAGG - Intergenic
976326982 4:83782863-83782885 CAGGGCATGGCCCTTTGTTTAGG + Intergenic
977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG + Intergenic
981079283 4:140622686-140622708 GCTGGCCTGGCCCTTTCTTGGGG + Exonic
982199962 4:152950574-152950596 GCTGGGCTGCCCCTGTGTTGGGG + Intronic
985543827 5:499446-499468 CCAGGCCTGGGCCTGTGGTTAGG + Intronic
985599723 5:820918-820940 ACAGACCTGGGCCTGTGTTTAGG + Intronic
986402344 5:7394494-7394516 CCCGGCCTGGCCCTGTGCTCAGG + Intergenic
991619923 5:68534612-68534634 GCTTGGCTGGCCCTGTGGTTAGG - Intergenic
992124353 5:73625993-73626015 GCGGGCCTCGCCATGTGATGCGG + Intergenic
993680238 5:90868907-90868929 GCGGGTCTGGCTCAGTTTTTTGG - Intronic
995518064 5:112974000-112974022 GAGGGCTAGGCCCTTTGTTTTGG - Intergenic
997257468 5:132439996-132440018 CCGGGCCTTGTCCTGTGTTGTGG - Intronic
997412680 5:133702352-133702374 GCTGGTCTGGCCCTGTGCTCAGG - Intergenic
998390986 5:141786948-141786970 GCTGGCCAGGCCCTGGGATTGGG - Intergenic
999256315 5:150211653-150211675 GGGGGCCTGGCCCTTTGTTAGGG - Intronic
999261389 5:150241003-150241025 GGGGGCCTGGCCCAGGATTTTGG - Intronic
1001749660 5:174118877-174118899 GAGGGCCTGGCCCTGCCCTTAGG + Intronic
1003108303 6:3231826-3231848 CCCGGCCTGGCTCTGTGTCTAGG - Intronic
1003337149 6:5184929-5184951 GCGACCCTGACCCTGTGCTTGGG - Intronic
1006589073 6:35141161-35141183 GCGGGCCTGGGCCGGCGTTTCGG - Intronic
1006680344 6:35792735-35792757 GTGTGCCTGGCACCGTGTTTTGG - Intronic
1007780889 6:44254083-44254105 GTGGACTTGGTCCTGTGTTTTGG - Intronic
1018941487 6:168311109-168311131 GCGTGCCTGCCCCTGTGTCCGGG + Intronic
1019062228 6:169264825-169264847 GAGGGCCTGGTCCTGTGCTGTGG + Intergenic
1019498559 7:1352771-1352793 GAGGGCCTGGACCTGTGTGCCGG - Intergenic
1020238588 7:6374882-6374904 GTGGGCCTGGGCCTGTGTCGCGG + Intronic
1024428140 7:49253475-49253497 CCGTGCCTGGCCCTGTCTTTAGG + Intergenic
1025095859 7:56094860-56094882 CCGTGCCTGGCCCTTTTTTTTGG + Intergenic
1025263691 7:57439216-57439238 GCACGCCTGCCCCTGTGTTTTGG + Intergenic
1029999202 7:105040879-105040901 GCTGGCATGCCCCAGTGTTTTGG + Exonic
1034276676 7:149826824-149826846 GAGGGCCTGGCCCTGGGGTGGGG + Intergenic
1034349070 7:150404991-150405013 GTGGGCCTGGCCTTGGGATTAGG + Intronic
1034695277 7:153047947-153047969 CCAGGCCTGGCCCTGCGTGTAGG + Intergenic
1040475837 8:47776662-47776684 GCAGGCCTTGCCCTGGCTTTGGG + Intronic
1041734619 8:61096693-61096715 GTGAGCCTGGATCTGTGTTTTGG + Intronic
1043558258 8:81459668-81459690 TAGAGCCTGGCCCTGTGGTTTGG + Intronic
1049382219 8:142322843-142322865 GCCGGCCTGGCCGTGTCTGTGGG + Intronic
1049684687 8:143934545-143934567 GCCGACCTGGCCCTGCCTTTGGG - Intronic
1049774255 8:144397300-144397322 GCGGGCCTCGCCCTGTGTAGTGG + Exonic
1050120808 9:2305249-2305271 GAGGTGCTGGCCCTGTGTATGGG - Intergenic
1050805359 9:9670599-9670621 GTGGGCCTGGCCCAGTGTCCTGG + Intronic
1051191535 9:14518238-14518260 ATGGCCATGGCCCTGTGTTTTGG + Intergenic
1058434262 9:104947850-104947872 GCGTGCCTGGCCCTGAGCTGAGG + Intergenic
1060204462 9:121674409-121674431 GCAGGCCTTGCCCTGGGTGTGGG + Intronic
1060209931 9:121703380-121703402 GAGGGCCTGGTCCTTTTTTTGGG + Intronic
1060821553 9:126664325-126664347 GGGGGCCTGGTCCTGTGACTTGG - Intronic
1061160560 9:128891632-128891654 GGGAGCCTAGCCCTGGGTTTAGG - Intronic
1062005081 9:134234955-134234977 GAGGGCCTGCCCCTGTGTCAGGG - Intergenic
1062016397 9:134293383-134293405 GCAGACCTGGCCATGTGTTTGGG - Intergenic
1062334811 9:136060474-136060496 CTGGGCCTGGCCCTGTCTTCTGG - Intronic
1062588904 9:137264160-137264182 CAGGGCCTGGAGCTGTGTTTGGG + Intronic
1062610793 9:137372580-137372602 GTGGGCCTGGGCCTGAGCTTTGG - Intronic
1185642329 X:1595317-1595339 GGGCGCCTGGCCGTGTGTCTGGG + Intronic
1193640876 X:84008458-84008480 ACAGGCCTGGTCCTGTGTCTTGG - Intergenic
1197959419 X:131987999-131988021 GAGGGTCTGGCACTGTGTTAGGG - Intergenic
1198675405 X:139125689-139125711 CAGTGCCTGGCCCTGTGTTAGGG + Intronic