ID: 944512461

View in Genome Browser
Species Human (GRCh38)
Location 2:200477919-200477941
Sequence CCTTCCGGGGTAGTGTCGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944512453_944512461 -8 Left 944512453 2:200477904-200477926 CCTCGGAGGCCAGGCCCTTCCGG 0: 1
1: 0
2: 2
3: 21
4: 281
Right 944512461 2:200477919-200477941 CCTTCCGGGGTAGTGTCGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54
944512447_944512461 20 Left 944512447 2:200477876-200477898 CCCCGGCGAAGGCAGCACGCTGC 0: 1
1: 0
2: 0
3: 7
4: 59
Right 944512461 2:200477919-200477941 CCTTCCGGGGTAGTGTCGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54
944512449_944512461 18 Left 944512449 2:200477878-200477900 CCGGCGAAGGCAGCACGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 944512461 2:200477919-200477941 CCTTCCGGGGTAGTGTCGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54
944512448_944512461 19 Left 944512448 2:200477877-200477899 CCCGGCGAAGGCAGCACGCTGCA 0: 1
1: 0
2: 0
3: 3
4: 86
Right 944512461 2:200477919-200477941 CCTTCCGGGGTAGTGTCGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944512461 Original CRISPR CCTTCCGGGGTAGTGTCGGT AGG Exonic