ID: 944513046

View in Genome Browser
Species Human (GRCh38)
Location 2:200483479-200483501
Sequence GGGTGAATGGGGCAGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944513040_944513046 -7 Left 944513040 2:200483463-200483485 CCTTGGTTTTCTCCATGGGTGAA 0: 1
1: 0
2: 0
3: 26
4: 221
Right 944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG 0: 1
1: 0
2: 0
3: 20
4: 241
944513035_944513046 21 Left 944513035 2:200483435-200483457 CCAGGGTACATTTCTCAACATCT 0: 1
1: 0
2: 2
3: 50
4: 373
Right 944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG 0: 1
1: 0
2: 0
3: 20
4: 241
944513037_944513046 -2 Left 944513037 2:200483458-200483480 CCTTACCTTGGTTTTCTCCATGG 0: 1
1: 0
2: 3
3: 19
4: 287
Right 944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG 0: 1
1: 0
2: 0
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944513046 Original CRISPR GGGTGAATGGGGCAGGTAAC TGG Intergenic
901862937 1:12086459-12086481 GGGTGAGGGGGGCAGGTACTTGG - Intronic
903490966 1:23728269-23728291 GTTTGAATGGGGCAGGACACAGG - Intergenic
904106757 1:28091029-28091051 GGATGAATGATGCAGGTATCTGG - Intergenic
904439986 1:30524022-30524044 GAGTGAATGGGGAAGGAAAGGGG + Intergenic
904587101 1:31586625-31586647 GGCTGGATGGGGCAGGTTTCCGG + Intronic
906108694 1:43309354-43309376 GGGGGAAGGGGACAGGTCACAGG - Intronic
906190782 1:43898433-43898455 GGGTGGGTGGAGCAGGTAAGTGG + Intronic
906715064 1:47962512-47962534 GGGCAAAGGGGGCAGGTATCAGG - Intronic
916175308 1:162033175-162033197 TTGTGAATGGGGCAAGCAACGGG - Intergenic
916749203 1:167709114-167709136 GGTCAAATGGGGCAGGAAACTGG + Intergenic
920037329 1:203074847-203074869 GGGTGAGGGGGGCAGGTGGCAGG + Intronic
920220057 1:204390400-204390422 GAGGGAATGGGGCAGTTAAAGGG - Intergenic
920313993 1:205065041-205065063 GGGTGGATGGGGGAGGAAATGGG - Intronic
922449442 1:225725033-225725055 GGGTGAGGGGGCCAGGTCACTGG - Intergenic
924289527 1:242524035-242524057 GGGTGCATGCGGCAGGTGCCTGG + Intronic
1068550306 10:58400428-58400450 GGGTGCATGGGGCAGGAGAGGGG + Intergenic
1069505961 10:68998184-68998206 GGCTGAAGCGGGCAGGTCACGGG - Intronic
1069869330 10:71523659-71523681 GGAGGGATGGGGCAGGTCACTGG + Intronic
1070798866 10:79233237-79233259 GGGAGACTGAGGCAGGGAACAGG + Intronic
1075084640 10:119406477-119406499 GGGAGAATGGGACAGGTACTTGG - Intronic
1076223548 10:128754876-128754898 TGGCGAATGGGGCTGGTAGCCGG + Intergenic
1076946101 10:133651509-133651531 GGGTGAGTGGGGCAGGGGCCGGG - Intergenic
1078016167 11:7617001-7617023 GTGTGCATGGGGCAGGGAGCAGG - Intronic
1078232862 11:9458983-9459005 GGGAGAATGAGGCAGGAAAATGG - Intergenic
1078932200 11:15921209-15921231 GGGCGGATGGGGCAGGCAAAGGG + Intergenic
1082222653 11:49659052-49659074 GGATGAATGGGGCAAGTGAAAGG - Intergenic
1083184517 11:61009407-61009429 GAGCAAATGGGGCAGGTGACAGG + Intronic
1083262864 11:61532521-61532543 ATGGGAATGGGGCAGGTCACTGG + Intronic
1084561360 11:69907287-69907309 AGGTGGAAGGGGCAGGTAACTGG + Intergenic
1086303818 11:85459055-85459077 GGGTGTCAGGGACAGGTAACAGG + Intronic
1086626394 11:88960154-88960176 GGATGAATGGGGCAAGTGAAAGG + Intronic
1086748665 11:90462510-90462532 GGGTGAAAGGGGCAGTAACCAGG + Intergenic
1087202719 11:95362130-95362152 GGGTGAATGGGCCAGCTGCCTGG + Intergenic
1088641731 11:111879327-111879349 GGGTGAAAGGGCGAGGTGACAGG - Exonic
1089301465 11:117501567-117501589 GGATGGCTGGGGCAGGTCACTGG + Intronic
1089760802 11:120721664-120721686 GGGTGATTAGGGCAGGTGGCTGG + Intronic
1091265821 11:134270315-134270337 GGGTGAAAGGGGCAGGGAGCCGG - Intergenic
1092270445 12:7018919-7018941 GGGTTACTGGGGCATGTAACGGG + Intronic
1093614411 12:21204823-21204845 TGGTGGATGGGGCAGGCAAAGGG + Intronic
1096115822 12:49054498-49054520 AGGAGAATGGGGCAGGAAATGGG - Intronic
1096685547 12:53286146-53286168 GGGTGAATGGGACAGGAAGTTGG - Exonic
1097279028 12:57833185-57833207 GGGTGAAAGGGGCAGCTGGCTGG + Intronic
1099671870 12:85704731-85704753 GGAGGACTGGGGCAGGTAAAAGG - Intergenic
1100212092 12:92408219-92408241 GGGTGGAAGGGGCAGTTAAAGGG - Intergenic
1102235456 12:111291637-111291659 GGGTGGCTGGGGCAGGGAACTGG + Intronic
1102542729 12:113634441-113634463 GGGTGATTGGGGCAGGACAAGGG - Intergenic
1103072878 12:117959441-117959463 GGGTGGATGGGGCAGGTGGCTGG - Intronic
1105832073 13:24171518-24171540 GGGTGAATGGAGCAGCATACAGG + Intronic
1106261797 13:28074048-28074070 GGGGGAATGGGGTTGGTAGCAGG - Intronic
1106849820 13:33777899-33777921 GAGTGAATGGAGCAGATGACAGG - Intergenic
1112310155 13:98310962-98310984 GGGTTCATGGAGCAGGAAACAGG + Intronic
1113918295 13:113887944-113887966 GGGTGAATGGATAAGGAAACTGG - Intergenic
1114650224 14:24280032-24280054 GGATGAATGGGACAGGGAAAGGG - Intergenic
1115892376 14:38045803-38045825 GGGAGAAAGGAACAGGTAACAGG + Intergenic
1117724953 14:58663876-58663898 GGGTGAAGGGGTGAGGTTACTGG - Intergenic
1119354554 14:73994996-73995018 GGGTAAAGGTGGCAGGAAACAGG - Intronic
1119965054 14:78905294-78905316 GGGTGAATGGCGCAGTAAACAGG - Intronic
1121109082 14:91300202-91300224 AGGGGCATGGGGCAGGGAACAGG + Intronic
1122018974 14:98820750-98820772 GGGAAAATGGGGGAGGAAACGGG - Intergenic
1123123587 14:105929322-105929344 GGGTGCCTGGGGCAGGTCTCAGG - Intronic
1123406228 15:20020824-20020846 GGGTGCCTGGGGCAGGTCTCAGG - Intergenic
1123515558 15:21027472-21027494 GGGTGCCTGGGGCAGGTCTCAGG - Intergenic
1124973685 15:34514548-34514570 GGGAGAAAGGGGCGGGGAACTGG + Intergenic
1125375090 15:39020240-39020262 GTGTGAAGGGGGCAGGAAAGGGG + Intergenic
1125811603 15:42547026-42547048 GGGAGGGTGGGGTAGGTAACAGG - Intronic
1126176266 15:45738589-45738611 GGTTGAAGGGGGCAGATGACGGG + Intergenic
1126913624 15:53441270-53441292 GAGTGAATGGGGCATGAAAATGG - Intergenic
1128107538 15:65055663-65055685 GGGTCCCTGGGGCAGGAAACAGG + Intronic
1128249644 15:66155343-66155365 GGGAGAGTGGGGCAGGAAAGAGG + Intronic
1128317663 15:66671254-66671276 GAGTGGCTGGGGCAGGTAGCGGG - Intronic
1129411297 15:75352007-75352029 GGGTGCAAGGGGAAGGAAACTGG - Intronic
1130856154 15:87841596-87841618 GGGTGGAGGGGGCAGGTCCCTGG - Intergenic
1131967764 15:97862633-97862655 TTGTGAAGGGGGCAGGTAAGAGG - Intergenic
1132935537 16:2478705-2478727 GGGGGAATGGGGCAGGGTAGTGG + Intronic
1133013223 16:2926083-2926105 TGGGGAATGGGGCAGGGACCTGG - Intronic
1133320247 16:4909192-4909214 GGGTGTAGGGGGCAGATAAGTGG - Intronic
1134524267 16:14932231-14932253 GGGTGTGTGGTGCAGGTCACCGG + Intronic
1134711856 16:16330718-16330740 GGGTGTGTGGTGCAGGTCACCGG + Intergenic
1134954972 16:18377976-18377998 GGGTGTGTGGTGCAGGTCACCGG - Intergenic
1136451417 16:30356106-30356128 GGGGGAATTGGGGAGGTAGCGGG + Intergenic
1136786842 16:32939876-32939898 GGGTGGATGGGGCAAGGCACAGG + Intergenic
1136882930 16:33913914-33913936 GGGTGGATGGGGCAAGGCACAGG - Intergenic
1137454403 16:48607459-48607481 GGCTGAATGAGACAGGTGACAGG + Intronic
1139325796 16:66151775-66151797 GGATGTATAGGGCAGGTATCTGG - Intergenic
1139365469 16:66429707-66429729 GGGTGAATGGGGAAGGGGAGGGG - Intronic
1140400070 16:74664509-74664531 GGGAGACTGAGGCAGGTAGCTGG + Intronic
1141413254 16:83850831-83850853 GGGTGTGTGGGGGAGGTCACAGG - Intergenic
1141521077 16:84580060-84580082 AGGTGCCTGGGGCAGGTACCAGG + Intronic
1142319223 16:89370364-89370386 GTGTGGCTGGGGCAGGTACCGGG - Intronic
1203089078 16_KI270728v1_random:1201546-1201568 GGGTGGATGGGGCAAGGCACAGG + Intergenic
1143099520 17:4497825-4497847 AGGTGAATGGGGGAGGGAAGGGG + Intergenic
1143476076 17:7204701-7204723 GGGGGGATGGGGCAGGAAATGGG - Intronic
1143748826 17:9013603-9013625 GTGTGAATGGGCCAGGGAACAGG - Intergenic
1146930879 17:36777048-36777070 GGGGGGATGGGGGAGGTAACTGG - Intergenic
1147147191 17:38492015-38492037 GGGTGGATGGGGCAGGGCACAGG + Intronic
1147644456 17:42025520-42025542 AGGTGAGTGGGGCAGGTGCCCGG + Exonic
1147882406 17:43662688-43662710 AGGTGAAGGGGGCAGGGAGCAGG - Intergenic
1148439704 17:47705541-47705563 GGAAGAATGGGTCAGGTAAGTGG - Intronic
1153438031 18:5087668-5087690 GGGAGAAAGGGGCATGTACCTGG - Intergenic
1153608160 18:6855144-6855166 GGCAGAAAGGGGCAGGTACCTGG + Intronic
1153610211 18:6877312-6877334 GGATGAAAGGGGCAGGAACCAGG + Intronic
1154145878 18:11865865-11865887 GGGTGACTGGGCAAGGTAAAGGG - Intronic
1156016602 18:32553660-32553682 GAGTGAATGGGGCAGGAAAAGGG - Intergenic
1157544624 18:48539247-48539269 GGGGGAAGGGGGCAGGGAAGGGG - Exonic
1157863517 18:51161911-51161933 GGGAGAATGGGGCAGGCAGTGGG + Intergenic
1158810023 18:61021416-61021438 GGGAGAAAGGGGGTGGTAACTGG - Intergenic
1159629058 18:70728142-70728164 GGGTGATTAGGGCAGGTAGATGG - Intergenic
1160886402 19:1351011-1351033 GTGTGAAGGGGGCTGGTAATTGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161750869 19:6095616-6095638 GGGTGTGTGGGGCAGGGAAGGGG + Intronic
1163102924 19:15108506-15108528 GGGTAAAAGGGGCAGGGGACTGG + Intronic
1163318372 19:16556915-16556937 GGGTGTATGGCACAGGTAAATGG - Intronic
1163977008 19:20862150-20862172 GGGTGAATGGGTTAGCCAACTGG - Intronic
1165478452 19:36046501-36046523 AGGTGGAGGGGGCAGGTAGCTGG + Intronic
1166422967 19:42652819-42652841 GGGTGCAGAGGGCAGGTTACAGG - Intronic
1168137307 19:54360234-54360256 GGGAGAATGGGGCAAGCAGCGGG - Intronic
1168160770 19:54508851-54508873 GGGAGAATGGGGCAAGCAGCGGG + Intronic
1168675487 19:58275037-58275059 GGGAGAAAGGGGGTGGTAACTGG + Intronic
925480117 2:4261286-4261308 GGGAAAATGGGGCAGGGAACAGG + Intergenic
925502566 2:4522568-4522590 GGGTTATGGGGGCAGGTACCTGG - Intergenic
926288727 2:11511518-11511540 GGGTGGGTGGAGAAGGTAACAGG + Intergenic
926874316 2:17457909-17457931 GGGTGTATAGGTCAGGTCACAGG - Intergenic
927199134 2:20567739-20567761 GGGTGAAAGGGCAAGGTCACAGG - Intronic
930853618 2:55988309-55988331 GGGTGAATGAGGAAGATAACTGG + Intergenic
931386803 2:61805148-61805170 TGGGGCATGGGGCAGGTTACAGG - Intergenic
931557128 2:63518397-63518419 GGGTGAGTTGAGCAGGTAAATGG + Intronic
933993935 2:87654122-87654144 GGGTGAGAGGGGCAGGGAAGGGG - Intergenic
936299930 2:111296792-111296814 GGGTGAGAGGGGCAGGGAAGGGG + Intergenic
937916781 2:127103137-127103159 GGGTGACTTGGGCAGGTGGCTGG + Intronic
938274560 2:130006375-130006397 GGGTGAAAGGGTAAGGGAACTGG - Intergenic
938293029 2:130160378-130160400 AGGTGAATGGGACAGATCACTGG + Intronic
938440807 2:131330897-131330919 GGGTGAAAGGGTAAGGGAACTGG + Intronic
939741440 2:145912306-145912328 GGTTGAAAGGGGCAGGTTCCTGG - Intergenic
944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG + Intergenic
945760359 2:213906142-213906164 GGGTGAATGTGGCAGGGAGGTGG - Intronic
946974356 2:225131714-225131736 ATGGGAATGGGGCAGGCAACAGG - Intergenic
948460145 2:238125243-238125265 GGGTGAATGGGCCTGGTCAGTGG - Intronic
949007921 2:241660793-241660815 GGGAGGATGGGGCAGTGAACAGG - Intronic
1169294461 20:4381751-4381773 GGGTGAACAGGGCTGGTAAAGGG + Intergenic
1169380722 20:5104881-5104903 GGGGGAATGGGGAAGGTTAACGG + Intronic
1169392581 20:5202517-5202539 GGGTGGATGGAGCAGGGAAGTGG + Intergenic
1170181577 20:13536278-13536300 GAATGAATGGGGCAGGTATTTGG - Intronic
1172894923 20:38293732-38293754 GGGGGCAGGGGGCAGGGAACGGG + Intronic
1173617810 20:44414280-44414302 GGGGGCAGGGGGCAGGTAACAGG + Intronic
1175766231 20:61594546-61594568 GGGTGAGTGGGGCAGCTCAGTGG + Intronic
1176429762 21:6568410-6568432 TGGTGAATGGGGCTGGACACTGG - Intergenic
1176688304 21:9874465-9874487 GGGTGACTGAGGCAGGAGACTGG + Intergenic
1179109541 21:38434374-38434396 AGGTGAATAGGGCAGGTATCAGG - Intronic
1179109548 21:38434405-38434427 AGGTGAATAGAGCAGGTACCAGG - Intronic
1179705156 21:43175872-43175894 TGGTGAATGGGGCTGGACACTGG - Intergenic
1182547115 22:31082792-31082814 GGGTGGGTGGGGCAGGAAACTGG + Intronic
1182572589 22:31249832-31249854 GGGGGAAGGGGGAAGGGAACTGG + Intronic
1184254987 22:43281523-43281545 GGGTGACTGAGGGAGGTGACAGG - Intronic
1185284686 22:49994988-49995010 GGGTGAGTGGGGCTGGGATCTGG + Exonic
1185320938 22:50200068-50200090 GCGTGCGTTGGGCAGGTAACTGG - Intergenic
949810408 3:8001133-8001155 GGGTGGGTGGGGCAGGCAAAGGG - Intergenic
949980447 3:9499315-9499337 GTGTGGATGGGGCAGGTGGCAGG - Exonic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
953039670 3:39244506-39244528 GGATCAATGGGGGAGGTTACTGG - Intergenic
960502688 3:118456041-118456063 GTGTGCATGGGGCAGGAAACTGG - Intergenic
960995254 3:123336233-123336255 GGGTGGAGGGGGCAGGTGCCTGG - Intronic
961486111 3:127217876-127217898 TGGTGAGTGGGACAGGAAACAGG - Intergenic
962975465 3:140442281-140442303 GGGTGATTAGGGCAGGTGAATGG - Intronic
963336062 3:143973682-143973704 AGATGAATAGGGCAGGTCACAGG - Intronic
964480348 3:157133067-157133089 GGAAGAAGGGGGCAGGAAACTGG - Intergenic
964668662 3:159201737-159201759 AGGTGAATGAGGCAGGTGAATGG - Intronic
964700800 3:159563970-159563992 GGGAGAATGGGGCAGGCAGAAGG - Intronic
964725114 3:159806347-159806369 GTCTGTATGTGGCAGGTAACAGG + Intronic
966448199 3:180027264-180027286 GGGTGAAGGGTCCAGGGAACAGG - Intronic
968032833 3:195517314-195517336 GTGTGAATGGGGGAGGAAAGGGG + Intronic
968544775 4:1193308-1193330 GGGTGTGTGGGGCAGGGGACAGG - Intronic
968601508 4:1512083-1512105 GGGTGGATGGGGGAGGTGAGAGG + Intergenic
968705795 4:2076837-2076859 GGCGGATTGGGGCAGGTCACCGG - Intronic
968971348 4:3797043-3797065 AGGTGAATGGGGCAGCCACCAGG - Intergenic
971366280 4:25979592-25979614 GGGTGGATGCGGCAGGAAAAAGG - Intergenic
971367412 4:25988444-25988466 GGGTGAATGTGGAAGGTGATTGG + Intergenic
975595882 4:76047960-76047982 GGGAGAAGGGGACAGGTACCCGG + Intronic
979267696 4:118722337-118722359 GTGTAAATGGGGCTGATAACAGG + Intergenic
979440920 4:120748923-120748945 GACTGAATGGGGGAGCTAACTGG + Intronic
982091173 4:151881087-151881109 GGTTGAATGGGCCAGGTGAGAGG - Intergenic
982091425 4:151883205-151883227 GGTTGAATGGGCCAAGTAAGAGG - Intergenic
982329257 4:154163178-154163200 GGGTGAAAGGGGAAAGTCACAGG + Intergenic
985449511 4:190052163-190052185 GGGTGAGTGGGGCAGGGGCCGGG - Intergenic
985774112 5:1831773-1831795 GGGGGAAGGGGGCTGGGAACAGG - Intergenic
986517700 5:8581117-8581139 GGAGGAATGGGGCAGGTGCCAGG - Intergenic
988093230 5:26569220-26569242 AGGTGAATGGGGCAGGCCCCTGG - Intergenic
989710359 5:44389557-44389579 GGGTGAAAGGGGCAGAGAAGGGG + Intronic
990893370 5:60671655-60671677 GGATAAATGGGGAAGGGAACAGG - Intronic
991258326 5:64639578-64639600 GGGTGAATGGGGCAGGGTAGGGG - Intergenic
991461048 5:66859500-66859522 GGGTTTATGGGAAAGGTAACAGG - Intronic
992595915 5:78347289-78347311 TGGAGAATGAGACAGGTAACAGG - Intergenic
992822041 5:80507248-80507270 GGGTGACTGTGGCAGTTAGCAGG + Intronic
993884280 5:93397957-93397979 GATAGAATGGGCCAGGTAACCGG + Intergenic
994328031 5:98471969-98471991 GGGTGAGTGGGGGAGGCAAGTGG + Intergenic
995158511 5:108945380-108945402 AAGTGAATGGGGTAGGTAAGAGG - Intronic
999174098 5:149619374-149619396 GAGTGAAGTGTGCAGGTAACAGG + Intronic
999232597 5:150070373-150070395 GGTTGACTGGGGCAGGGCACAGG - Intronic
1002355459 5:178625820-178625842 GGGTGAGTGGGGGAGGTCAGAGG - Intronic
1002783203 6:382622-382644 GGGTGGATGGGGCAGCCAACAGG + Intergenic
1003251051 6:4429546-4429568 GAGTGACTGGGACTGGTAACTGG - Intergenic
1007655172 6:43447368-43447390 GGGTTCCTGGGGCAGGTCACAGG - Exonic
1009842281 6:69092808-69092830 GGGTGACTGGGGGAGGGAAGGGG + Intronic
1010349717 6:74858958-74858980 GGGTGAATGAGACAGGCAATTGG - Intergenic
1011211851 6:84964150-84964172 GGGTGAAAGGGACAGCCAACTGG + Intergenic
1011643738 6:89438026-89438048 AGATGAATGGGGTAGGTAAGTGG + Intronic
1016356125 6:143220097-143220119 GGGGGCAGGGGGCAGGTCACAGG + Intronic
1018311430 6:162513634-162513656 GAGTGACTGGAGAAGGTAACTGG + Intronic
1019308595 7:347944-347966 GGGTGCATGGGGCAGCTGAGGGG + Intergenic
1019762444 7:2823413-2823435 GAGTGCTTGGGGAAGGTAACAGG + Intronic
1019916034 7:4133301-4133323 GGGTGAATGAGTCAAGGAACTGG - Intronic
1022902491 7:34824895-34824917 GGATGAAGAGGGCAGGTAATAGG - Intronic
1026342434 7:69445941-69445963 GGGTGACTGGAGAAGGTAAGAGG + Intergenic
1027505734 7:79015926-79015948 GGGTCAAAGGGGCAGGAAGCAGG + Intronic
1028674386 7:93442332-93442354 GGGTCAATGGGGCAGATAGGCGG - Intronic
1029361078 7:100089052-100089074 AGGTGGATGCAGCAGGTAACGGG + Exonic
1030007269 7:105131927-105131949 TGCTGAATGGGCCAGGAAACAGG + Intronic
1031347112 7:120681381-120681403 GGAGGAATGGGGAAGGTGACGGG + Intronic
1033134323 7:138772451-138772473 GGGTGAGTGGGGCAGGGGAATGG + Intronic
1035453078 7:158991648-158991670 GGGTGAATGGAGAAGTGAACTGG + Intergenic
1036590291 8:10162519-10162541 TGTTGAGTGGGGCAGGTGACGGG + Intronic
1037866764 8:22450396-22450418 GGGTGAGTGGTGCAATTAACAGG - Intronic
1038667950 8:29557586-29557608 TGGTCAATGGGGGAGGGAACTGG - Intergenic
1041616808 8:59916751-59916773 GGATGAAGGGGGCAGGTTAGGGG + Intergenic
1041738085 8:61132475-61132497 GGCTGAATGGGGCAGGCTTCAGG + Intronic
1042004908 8:64169389-64169411 GGCAGAAGGGGGCAGGTCACCGG + Intergenic
1042593952 8:70425484-70425506 AGAGGAATGGGGCAGGGAACAGG - Intergenic
1043550374 8:81364804-81364826 TGTTAAATGGGGCAGGAAACCGG - Intergenic
1045395372 8:101755517-101755539 GGGTGAATGGTGGAGGAAAGAGG - Intronic
1047544718 8:125804491-125804513 GGGTGGAGGGGCCAGGTAGCAGG + Intergenic
1048329711 8:133463482-133463504 TGGTTAATGGGGCAGGGGACAGG + Intronic
1049066650 8:140321616-140321638 GGGAGAATTGGGCAGAGAACGGG + Intronic
1049594447 8:143476968-143476990 GGCTGGATGGGGCAGGTACAGGG + Intronic
1049606211 8:143530317-143530339 GGGGGAAGGGGGCAGGCCACCGG + Intronic
1049723244 8:144131203-144131225 GGTTGAATGAGGCAGATACCTGG + Intergenic
1050221283 9:3393254-3393276 GGGAGAATGGGGGAGGTTAAAGG + Intronic
1050336544 9:4595228-4595250 GGGTGTATGGGGGAGGTACCTGG - Intronic
1050388491 9:5113128-5113150 GGGTCCATGGGGCAGGTCACAGG - Intronic
1051067613 9:13123235-13123257 GGGATAATGGGGCAGGTTGCAGG + Exonic
1053415093 9:37942460-37942482 AGGTGACTTGGGCAGGTATCTGG - Intronic
1053781037 9:41607420-41607442 GGGTGACTGAGGCAGGAGACTGG - Intergenic
1054168980 9:61817573-61817595 GGGTGACTGAGGCAGGAGACTGG - Intergenic
1054668552 9:67763243-67763265 GGGTGACTGAGGCAGGAGACTGG + Intergenic
1055441290 9:76338924-76338946 GGGTGGGTTGGGCAGGCAACAGG - Intronic
1055496182 9:76857809-76857831 AGGTGTCTGGGGCAGGTAATGGG + Intronic
1057196040 9:93115976-93115998 GGGTGAAGGAGGGAGGTGACGGG + Intergenic
1057213119 9:93211978-93212000 GCGTGAATGGGGCAGATGAGTGG - Intronic
1057699931 9:97356362-97356384 GGGTGAAATGGGCAGGAAGCTGG - Intronic
1059704620 9:116809868-116809890 GGCTGAAGGGGCCATGTAACTGG + Intronic
1060190340 9:121588570-121588592 GGGTGAAGGGGGAAGGGAAGGGG + Intronic
1186708989 X:12173211-12173233 GGTTGTATGAGGCAGGTAATTGG + Intronic
1188136461 X:26499697-26499719 GGGAGAATGGGACATGTACCTGG - Intergenic
1188700394 X:33252607-33252629 GGTTGAATGGGGGGGGTGACAGG + Intronic
1191778349 X:64842965-64842987 GGGTGAAAGGGGGAGGGAAAAGG - Intergenic
1191868226 X:65723165-65723187 AGGTGTATGGGGCAGGTTCCAGG + Intronic
1194142585 X:90223121-90223143 AGGCGAATGGGGCTGGGAACAGG + Intergenic
1194659977 X:96620320-96620342 GAGTGAGTGGGGCAGGAAAGGGG + Intergenic
1196644339 X:118100563-118100585 GGCTGAATGGGTCATGAAACTGG - Intronic
1197816919 X:130507242-130507264 GGATGAATGGGGCAGGAGAAAGG - Intergenic
1197993894 X:132351473-132351495 AGTAGAATGGGACAGGTAACTGG + Intergenic
1199948572 X:152687042-152687064 GGGAGAATGGGGCAGGAGAATGG + Intergenic
1199961106 X:152781414-152781436 GGGAGAATGGGGCAGGAGAATGG - Intergenic
1200488339 Y:3792222-3792244 AGGCGAATGGGGCTGGGAACAGG + Intergenic