ID: 944513068

View in Genome Browser
Species Human (GRCh38)
Location 2:200483713-200483735
Sequence CAACAGGAATAGCTGATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944513068 Original CRISPR CAACAGGAATAGCTGATACA GGG Intergenic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
905106832 1:35568456-35568478 CAAGAGGAATGGCTGAGCCAGGG + Intergenic
906321249 1:44818310-44818332 CAACAGGACCAGCTGATGGAAGG + Intergenic
909848203 1:80424894-80424916 CAATAGGAATATTTGATACTTGG - Intergenic
912145318 1:106786632-106786654 CAACGGGAATAGTTTGTACAAGG - Intergenic
912501115 1:110122434-110122456 CAAGAGGAATGCCTGACACACGG + Intergenic
913974560 1:143444602-143444624 CCACAGTAATAACTGATTCAGGG + Intergenic
914068950 1:144270218-144270240 CCACAGTAATAACTGATTCAGGG + Intergenic
914110205 1:144696136-144696158 CCACAGTAATAACTGATTCAGGG - Intergenic
916823656 1:168424379-168424401 CATTAGGAAGAGCTGATTCATGG - Intergenic
916892629 1:169127007-169127029 CAAAAGGAATAGCTGGTATATGG - Intronic
922682794 1:227614770-227614792 CAGGTGGAATAACTGATACATGG - Intronic
1064831507 10:19472873-19472895 GAACAGAAATAAATGATACAGGG - Intronic
1067070751 10:43129397-43129419 ACACAGGAAGAGCTGATCCATGG - Exonic
1067358669 10:45555897-45555919 CCAGAGGTATAGCTTATACAGGG - Intronic
1075485606 10:122819779-122819801 CATCAGGAATAGCTGGAACCAGG - Intergenic
1079711524 11:23689029-23689051 CAAGAGGAAGAGATTATACAAGG + Intergenic
1079940872 11:26678794-26678816 GACCTGGAATAGCTGATACCTGG - Exonic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1081929153 11:46856471-46856493 GAACAGAAATAGAAGATACATGG + Intergenic
1084089013 11:66868136-66868158 CAACAGGATTATCTGATTGAAGG - Intronic
1086066600 11:82751696-82751718 GTACACAAATAGCTGATACAAGG - Intergenic
1089315279 11:117587184-117587206 TAACTGAAATAGCTGATACATGG + Intronic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090610080 11:128463281-128463303 TTACAGGATTAGCTGATAGAAGG - Intronic
1091149571 11:133315183-133315205 CAAAAGGAAAAGTAGATACATGG - Intronic
1091391356 12:128233-128255 AAACAGGAAATGCTGACACAGGG - Intronic
1091941134 12:4483412-4483434 CCTCAGAAGTAGCTGATACAAGG + Intergenic
1092006258 12:5072968-5072990 CAGTAGGAATAGATTATACATGG + Intergenic
1092127349 12:6084329-6084351 AGACAGGAGTAGCTGATGCAGGG - Intronic
1093035380 12:14327630-14327652 CAGCAGGAAAAGCTGAAATATGG - Intergenic
1094092712 12:26669023-26669045 CAAGAGGAATTGCTGAAACCTGG + Intronic
1094455550 12:30628826-30628848 TATCAGGAACAGCTAATACATGG - Intergenic
1102267631 12:111501325-111501347 AAACAGGAATGGCTGAAAAAAGG + Intronic
1104285596 12:127421660-127421682 CAGCAGGAAGAGCAGATACACGG - Intergenic
1104713286 12:131000234-131000256 CAACAAAAATAGCTGAGTCATGG - Intronic
1108604825 13:52026947-52026969 GAACAGGAACAGCTGAGAAATGG + Intronic
1110526296 13:76542112-76542134 CGACAGGAAAAGAAGATACAGGG - Intergenic
1112194173 13:97208492-97208514 CAAAAGTAAAAGCTGATTCATGG + Intergenic
1117397895 14:55329021-55329043 CAACAGGATTGATTGATACACGG - Intronic
1118417401 14:65556640-65556662 CAAGAGGAGGAGATGATACAAGG + Intronic
1119170221 14:72529292-72529314 CAGCAGTAATAGCAGATCCAAGG - Intronic
1121807208 14:96839105-96839127 GAACAGGAATAACTCATTCACGG - Intronic
1122421218 14:101578746-101578768 CCCCAGGAAAAGCTGACACATGG + Intergenic
1125144623 15:36452600-36452622 CCAAAGGAATAGCTGCTACTAGG + Intergenic
1125840036 15:42791744-42791766 GTACAGGAATAGCAGATACAAGG - Intronic
1126705430 15:51401263-51401285 CAACAGGAATAGCAGATACTTGG - Intronic
1128427612 15:67558306-67558328 CAACAGGACTTGCTGATGAATGG - Intronic
1130420894 15:83745946-83745968 CAACACTAATAACTGATAGAGGG - Intronic
1130817447 15:87452859-87452881 CAAGAGGAAGAGATTATACAAGG + Intergenic
1131059268 15:89394564-89394586 CCACTGGTACAGCTGATACATGG + Intergenic
1131867788 15:96730535-96730557 CAACAGGATTTGCTGATTAATGG - Intergenic
1137540112 16:49356213-49356235 CAACAGGAAAAGTTTATACAAGG - Intergenic
1137992716 16:53176015-53176037 CAGCAGGAGAAACTGATACATGG - Intronic
1138176184 16:54900253-54900275 CAACAATAACAGCTGATAGAAGG - Intergenic
1140300375 16:73751813-73751835 CAACAGGCATCTCTGATACAAGG - Intergenic
1141280141 16:82623954-82623976 CGAGAGGAATAGATGATAGAGGG + Intergenic
1145166966 17:20621365-20621387 AAACAGGCAAAGCTGATACATGG + Intergenic
1145917768 17:28586126-28586148 CAACAGGGATAGGTGAAGCAAGG + Exonic
1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG + Intronic
1150651656 17:67014281-67014303 GAAAATGAATAGCTGATGCAAGG - Intronic
1153329273 18:3856479-3856501 CAACAGAAATAGCTAATAGGTGG + Intronic
1155902051 18:31403593-31403615 CACCAGGAATAGCTGACATGTGG + Exonic
1157173859 18:45432887-45432909 CAAAAGGATTTGCTAATACATGG - Intronic
1158632376 18:59126855-59126877 ATACAGGACTAGCAGATACAGGG + Intergenic
1159317285 18:66792650-66792672 CAACAGGATTAGCTCATTCTAGG + Intergenic
1159485065 18:69044996-69045018 CAACAAGAAAAGGTGATGCAAGG - Intronic
1160237441 18:77097290-77097312 CAACAGGAAGAGCTGCCACAGGG - Intronic
1160248670 18:77181985-77182007 CAACAAGAACATCTGAAACAGGG + Intergenic
1166426322 19:42681533-42681555 CAAGAGGCATAGCTGGGACATGG + Intronic
928039558 2:27861295-27861317 GAACAGGAATAGATGCTATACGG - Intronic
932146124 2:69318926-69318948 CAAAAGGGATAGCTGATCCATGG + Intergenic
932525640 2:72464204-72464226 CATCAGCAATTGCTGATACTGGG + Intronic
933099673 2:78237251-78237273 CAACATGAGTAACTGATAAAAGG + Intergenic
933167086 2:79088121-79088143 CATCAGGAATAGCTTATTCCTGG + Intergenic
934179263 2:89605577-89605599 CCACAGTAATAACTGATTCAGGG + Intergenic
934289550 2:91679840-91679862 CCACAGTAATAACTGATTCAGGG + Intergenic
934953873 2:98600192-98600214 CCACAGGCATAGCTGATGCTAGG - Exonic
936616156 2:114049701-114049723 CAACAGGAATAGATGTTCCCAGG + Intergenic
936986133 2:118312653-118312675 AAACAGGAATACCTGCCACACGG + Intergenic
939006199 2:136790557-136790579 CAACAGGAAAATAAGATACAAGG - Intronic
940087158 2:149873158-149873180 CCACAGGAATATCTGATACAGGG + Intergenic
940191776 2:151048243-151048265 TCAGAGCAATAGCTGATACAGGG + Intronic
941403135 2:165056451-165056473 CCACAGGACCAGCTGATTCATGG - Intergenic
942213231 2:173692775-173692797 CAACAGGGACAGCTGATGCCAGG + Intergenic
944124411 2:196277157-196277179 CAAAAGGAAGAACTGAAACAAGG + Intronic
944513068 2:200483713-200483735 CAACAGGAATAGCTGATACAGGG + Intergenic
944803828 2:203261621-203261643 AAAAAGGAATAGCAGATATATGG + Intronic
947052750 2:226064827-226064849 TAAAAGGAATAGCTGAGACTGGG - Intergenic
947945964 2:234102564-234102586 CAACAGGGAGAGCTGATGCTGGG - Intergenic
1175391673 20:58631485-58631507 TAACAGGAAGCCCTGATACAGGG - Intergenic
1176371297 21:6063076-6063098 AAACAGAAATAGCGGATACCTGG - Intergenic
1178805957 21:35839277-35839299 CATCATGAATGGCTGATACTTGG - Intronic
1179109311 21:38432635-38432657 TAACAGCAATAGCTGACACCTGG - Intronic
1179752222 21:43475463-43475485 AAACAGAAATAGCGGATACCTGG + Intergenic
1183928548 22:41223164-41223186 CAACAGGCAAAGCTGACACAGGG - Intronic
949460533 3:4288443-4288465 CAACGGGAAGAGCTGTTTCAGGG - Intronic
949515720 3:4805173-4805195 CTTCAGGCACAGCTGATACAGGG + Intronic
952544474 3:34404096-34404118 CAAAAGGAAGAGATTATACATGG - Intergenic
952604301 3:35125760-35125782 CAGCAGCAGTAGCTGCTACAAGG - Intergenic
956902375 3:73730179-73730201 CAACAGGATTAGCTGGGTCAAGG - Intergenic
961288248 3:125824156-125824178 CAAGAAGAAGAGATGATACAGGG - Intergenic
964481603 3:157144019-157144041 GAAAAGTGATAGCTGATACAGGG + Intergenic
965430720 3:168584679-168584701 CAACTGGAAAAACTGATAAATGG + Intergenic
966483865 3:180446006-180446028 CTACAGGAATAGTAGATAAAAGG + Intergenic
966678037 3:182610468-182610490 CAACAGGCTGAACTGATACATGG + Intergenic
967780243 3:193430644-193430666 CAAAAGGAATAGCCAATGCAAGG + Intronic
969803979 4:9592044-9592066 CAAGAAGAAGAGGTGATACAGGG - Intergenic
969830011 4:9788041-9788063 CCACAGTAATAACTGATTCAGGG - Intronic
971610203 4:28714229-28714251 CCAGAGGAATAGCAGATATAAGG - Intergenic
975032936 4:69645551-69645573 CTACAGAAGTAGCTGATAAATGG - Intronic
976276228 4:83281651-83281673 CAACCGTAATAACAGATACATGG + Intronic
977411080 4:96664832-96664854 GTACTGGAATAGCGGATACATGG + Intergenic
977966794 4:103160365-103160387 CTACAGAAATGGCTGCTACATGG + Intronic
983368939 4:166834145-166834167 CAAGAGAAATATCTGAGACAGGG - Intronic
983877984 4:172899079-172899101 GGACAGGAATAGCTCATTCAGGG + Intronic
984684036 4:182645891-182645913 CAAGGGGAGTAGATGATACAAGG + Intronic
985384720 4:189433799-189433821 CAACAGGACTAGATGATAGGTGG - Intergenic
987211102 5:15684148-15684170 AAACAGTAATTGCTGATATATGG + Intronic
988510442 5:31860176-31860198 CACCAGGTATAGCTGAGGCAGGG - Intronic
992478018 5:77122635-77122657 CTAAAACAATAGCTGATACATGG - Intergenic
992884168 5:81141254-81141276 TAAAAGGAATAGAAGATACATGG - Intronic
993399478 5:87431089-87431111 GAACAGGAAAAGATGATACCTGG - Intergenic
996094610 5:119384944-119384966 CCACAGGAATAAAAGATACACGG + Intronic
997705714 5:135950380-135950402 AAACAGGAAGAACTAATACATGG + Intronic
998044784 5:138977876-138977898 CAGCAGGAATAGCCGTTGCAAGG - Intronic
1000236998 5:159371119-159371141 CAACTGGACTCTCTGATACAGGG - Intergenic
1001781084 5:174369743-174369765 CAACAATAATAGCTGACATATGG + Intergenic
1002937253 6:1684083-1684105 CAAAAAAAATAGCTGATAGAGGG - Intronic
1003641732 6:7880884-7880906 CAACAGCAATGACTGAGACAAGG - Exonic
1004304540 6:14487969-14487991 CAACAGGAAGACCAGCTACAGGG + Intergenic
1005802950 6:29445589-29445611 CCACAGGAGGAGCTGATGCAGGG - Intronic
1006382765 6:33710107-33710129 CAGCAGGACTTGCTGATATATGG - Intronic
1007846432 6:44761093-44761115 CAAGAGGCATAGCTGACCCAGGG + Intergenic
1007994704 6:46294193-46294215 CAACATGCATAGATGATTCACGG + Intronic
1008148641 6:47922728-47922750 CAACAGGACTCTGTGATACAAGG + Intronic
1012085693 6:94823656-94823678 CAACATGTATAGCTGATAAAAGG + Intergenic
1013816726 6:114108213-114108235 CTACAGGAATAGCAGCTATAAGG + Intronic
1015731426 6:136352171-136352193 AAATACGAATAGCAGATACAAGG - Intronic
1017596324 6:156032447-156032469 TAACAGCAATAGCAGAAACAGGG - Intergenic
1017600481 6:156075248-156075270 CAAAGGGTATAGCTGGTACAAGG - Intergenic
1017893225 6:158656389-158656411 TAACAGGAATAGTTGTCACAGGG - Intronic
1020942790 7:14562051-14562073 CAGCTGGAGTAGCTGAGACATGG - Intronic
1020990411 7:15188368-15188390 TAAGAAGAATAGCTGGTACATGG + Intergenic
1022614850 7:31919144-31919166 CAACAGAAATAGTTGAGCCATGG + Intronic
1025831212 7:65052246-65052268 AAACAGGGATAGATGATATAAGG - Intergenic
1025918361 7:65886126-65886148 AAACAGGGATAGATGATATAAGG - Intronic
1028424043 7:90666166-90666188 CAATAAGAATAGCAGGTACAGGG - Intronic
1028871538 7:95775942-95775964 CAAGAGGAATAACTTTTACATGG - Intronic
1030964791 7:115978173-115978195 CAACAGAAAAAGCTGAAACAAGG + Intronic
1031874044 7:127118284-127118306 TAACAGGAAAAGTTGATAAAAGG + Intronic
1032847424 7:135763437-135763459 CAATAGAAATAGCTACTACATGG + Intergenic
1033015270 7:137664519-137664541 CCACAGGACTATCTGATAGAAGG + Intronic
1033791396 7:144796042-144796064 GTATAGGAATAGCAGATACATGG - Intronic
1035130117 7:156643681-156643703 CAGCAGGAATGCCTGCTACAGGG - Intronic
1037709054 8:21341247-21341269 TATCAGGACTACCTGATACATGG + Intergenic
1040587284 8:48756028-48756050 AAAAAGGAATACCTGAGACAGGG + Intergenic
1041837498 8:62232900-62232922 CAAAAGGAACAGCAGCTACACGG - Intergenic
1042362732 8:67901010-67901032 GGATAAGAATAGCTGATACAAGG + Intergenic
1043051513 8:75391784-75391806 CAGCAGCAATAGCAGATTCATGG - Intergenic
1044958053 8:97502412-97502434 CAACAGGATTTGCTGACAAATGG + Intergenic
1046061578 8:109145819-109145841 GAACAAGAATAAATGATACATGG - Intergenic
1049443193 8:142618456-142618478 CAACAGGAAAAGAGGATACCTGG - Intergenic
1051468046 9:17403283-17403305 CAACAGGTATAGCTTCTACATGG + Intronic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1055794663 9:79962754-79962776 CAACAGCAAAGGTTGATACAGGG + Intergenic
1056128215 9:83557521-83557543 TAACAGGATTAGCAGACACATGG + Intergenic
1056254795 9:84788077-84788099 CCATAGTAATACCTGATACATGG - Intronic
1057977895 9:99625970-99625992 TAACAGCAATACCTGCTACATGG - Intergenic
1059875614 9:118631286-118631308 CAACAGAAAAAGCAAATACAAGG - Intergenic
1060039960 9:120291746-120291768 CAACAGGTACAACTGGTACAGGG - Intergenic
1061937826 9:133867940-133867962 CTACAGGAATTGCTCAGACAGGG + Intronic
1062333982 9:136056915-136056937 CGAGAGGAAGGGCTGATACACGG - Intronic
1190143731 X:47871549-47871571 CAACAGTAATAGAAGATACTAGG - Intronic
1191635783 X:63374583-63374605 CAAGAGGAATATCTATTACATGG + Intergenic
1192208850 X:69114207-69114229 CAACAGCAATTGCAGATACAAGG + Intergenic
1193420233 X:81274150-81274172 CAAGAGGAATAGGTGTCACAAGG - Intronic
1193739138 X:85196956-85196978 CAAAAGGCATAACTGATAAAAGG + Intergenic