ID: 944513937

View in Genome Browser
Species Human (GRCh38)
Location 2:200492143-200492165
Sequence AACCTCAGTGTGGAGTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944513937_944513945 28 Left 944513937 2:200492143-200492165 CCACCAGACTCCACACTGAGGTT 0: 1
1: 0
2: 3
3: 15
4: 182
Right 944513945 2:200492194-200492216 GTCACATAATTCTTTGTTCTGGG 0: 1
1: 2
2: 31
3: 196
4: 693
944513937_944513947 30 Left 944513937 2:200492143-200492165 CCACCAGACTCCACACTGAGGTT 0: 1
1: 0
2: 3
3: 15
4: 182
Right 944513947 2:200492196-200492218 CACATAATTCTTTGTTCTGGGGG 0: 1
1: 6
2: 85
3: 268
4: 800
944513937_944513944 27 Left 944513937 2:200492143-200492165 CCACCAGACTCCACACTGAGGTT 0: 1
1: 0
2: 3
3: 15
4: 182
Right 944513944 2:200492193-200492215 GGTCACATAATTCTTTGTTCTGG 0: 1
1: 2
2: 30
3: 217
4: 602
944513937_944513946 29 Left 944513937 2:200492143-200492165 CCACCAGACTCCACACTGAGGTT 0: 1
1: 0
2: 3
3: 15
4: 182
Right 944513946 2:200492195-200492217 TCACATAATTCTTTGTTCTGGGG 0: 1
1: 0
2: 20
3: 193
4: 771
944513937_944513942 6 Left 944513937 2:200492143-200492165 CCACCAGACTCCACACTGAGGTT 0: 1
1: 0
2: 3
3: 15
4: 182
Right 944513942 2:200492172-200492194 CCTCGGCACTATTACCATTTTGG 0: 1
1: 1
2: 31
3: 295
4: 969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944513937 Original CRISPR AACCTCAGTGTGGAGTCTGG TGG (reversed) Intronic
901314028 1:8293340-8293362 GACATCAGTGTAGACTCTGGAGG - Intergenic
902140556 1:14350178-14350200 AACCTCATCCTGGAGACTGGGGG - Intergenic
902299488 1:15491812-15491834 GACCTCAGGGTGGAGCCTTGTGG + Intronic
903442793 1:23401100-23401122 CAGCTCAGTGTGGACTCTGCTGG + Intronic
903648267 1:24907548-24907570 AACCTCTGTGAAGAGGCTGGCGG - Intronic
903884934 1:26535616-26535638 CACCTGAGAGTGAAGTCTGGGGG + Intronic
904332674 1:29772736-29772758 GAGCTCAGTGTGGACCCTGGAGG - Intergenic
910189600 1:84581950-84581972 AAGCACTGTGTTGAGTCTGGGGG - Intergenic
910841796 1:91568417-91568439 GACAGCAGTCTGGAGTCTGGTGG + Intergenic
910986926 1:93014241-93014263 AACATCAGTCTCTAGTCTGGAGG - Intergenic
911378972 1:97088622-97088644 AACCTCAGGGTGGAGTATGGAGG - Intronic
915633296 1:157168568-157168590 AAACTAGGTGTGGAGTCTGTGGG - Intergenic
915636571 1:157191084-157191106 AAACTAGGTGTGGAGTCTGTGGG - Intergenic
916232430 1:162553732-162553754 TACCTCAGTGTGGAATCCTGTGG + Intergenic
918760334 1:188396861-188396883 AACCTGAATGTGGGGTCTGTTGG - Intergenic
920391909 1:205610296-205610318 AACCTCAGAGTGGAGTGTCTTGG - Exonic
920697800 1:208194963-208194985 AACTTCAGCGTGGACTCTGGTGG - Intronic
922721805 1:227903472-227903494 AGCCTCACTCTGGGGTCTGGGGG + Intergenic
923233316 1:232008940-232008962 ATCCTCGGAGTGGAGCCTGGGGG - Intronic
923610648 1:235489804-235489826 GACCTCAGTGTAAAGTGTGGTGG - Intronic
1062860152 10:804505-804527 GACCTCAGGGTGGCGCCTGGTGG - Intergenic
1063071687 10:2672469-2672491 AGCCTCACTGTGGTGTCTGATGG + Intergenic
1063264044 10:4426115-4426137 ATCCCCAGTGTGGGGCCTGGTGG + Intergenic
1063717863 10:8546402-8546424 AACCTGAATGTGGAGTTTGAGGG - Intergenic
1064168357 10:13005979-13006001 CACCTCAGTATGGTTTCTGGGGG - Intronic
1068306006 10:55209191-55209213 AACAACAGAGTGGAGGCTGGTGG + Intronic
1073302638 10:102480395-102480417 GTCCTCAGTGTGCAGTCAGGAGG + Exonic
1075745250 10:124723066-124723088 TGACTCAGTGTGGAGTGTGGAGG - Intronic
1076433343 10:130422810-130422832 AACCTCAGTGGGGAATAGGGAGG - Intergenic
1078345223 11:10541558-10541580 ATCATCAGTGGGGAGGCTGGAGG - Intergenic
1081617246 11:44598156-44598178 TACCTCAGTGATGATTCTGGTGG + Intronic
1083491461 11:63017452-63017474 AAGCTCAGTCTGGACCCTGGGGG - Intergenic
1083765916 11:64841630-64841652 GAGGTCAGTGTGGAGTCTGGGGG - Exonic
1084257634 11:67954041-67954063 AACCTGAGTCTGGAGCCAGGCGG - Intergenic
1085743767 11:79097788-79097810 AAACTCAGTGAGGAGTTTGTGGG - Intronic
1087628937 11:100628000-100628022 AATCACAGTGTGGAGTGTTGGGG - Intergenic
1088959933 11:114652997-114653019 AACCTCTGTGTAAAATCTGGGGG + Intergenic
1089802892 11:121051452-121051474 AACCTCTTTGTGGAGGTTGGAGG - Intronic
1090450112 11:126798582-126798604 GAGCTCAGTGGGGAGTGTGGGGG + Intronic
1090503945 11:127289271-127289293 AGCCTTAGTGTTGAGTATGGTGG - Intergenic
1091644034 12:2260011-2260033 CACACCAGTGTGCAGTCTGGTGG - Intronic
1092512251 12:9169837-9169859 AACTTCATTGTAGAGTCTAGAGG + Intronic
1092587360 12:9912803-9912825 CACCTCAGTGGGCAGACTGGTGG + Intronic
1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG + Intronic
1092923983 12:13257545-13257567 AGCCTCAGTGTGGACGCAGGAGG + Intergenic
1093291130 12:17322972-17322994 TTTCTCAGTGTGGAGGCTGGTGG - Intergenic
1094390115 12:29939922-29939944 TACCCCAGTGTGCAGGCTGGTGG + Intergenic
1098508441 12:71282618-71282640 ACCCTCAGTGCGGGGTGTGGTGG + Intronic
1104190329 12:126476037-126476059 AAACTCAGTGTGGGGTATGTGGG + Intergenic
1105823122 13:24097436-24097458 AACCTCAGTTTTGAGTGTGTGGG + Intronic
1110468050 13:75825983-75826005 AACATCAAGGGGGAGTCTGGAGG - Intronic
1112918918 13:104586119-104586141 AATGTAAGTGTGGAGACTGGTGG + Intergenic
1112931905 13:104750990-104751012 ATCCTCACTGTGTTGTCTGGTGG - Intergenic
1114217439 14:20667390-20667412 AACCTCAGTTTGGTGTTTTGAGG - Intergenic
1117239342 14:53813172-53813194 AACCTCATCATGGAATCTGGAGG + Intergenic
1117591853 14:57278288-57278310 GACTTCAGTCTGGAGACTGGAGG + Intronic
1119071328 14:71587949-71587971 ATCATCAGTGTGGACTTTGGGGG - Exonic
1120311226 14:82830833-82830855 AGCCTCAGACTGGAGACTGGAGG + Intergenic
1120850835 14:89167979-89168001 AACTTCGGTGGGGAGCCTGGGGG - Intronic
1121319926 14:92986364-92986386 AGCCTGGGAGTGGAGTCTGGAGG + Intronic
1121723983 14:96132649-96132671 AACTTCAGTGAGGGGGCTGGGGG + Intergenic
1122354346 14:101114183-101114205 GACCTCAAGGTGGAATCTGGAGG - Intergenic
1122748915 14:103918645-103918667 AACCTCTGGGTTGAGCCTGGTGG - Intronic
1123664191 15:22595092-22595114 AACCTCATTTTGGGGTGTGGTGG - Intergenic
1124318022 15:28689528-28689550 AACCTCATTTTGGGGTGTGGTGG - Intergenic
1124565411 15:30807962-30807984 AACCTCATTTTGGGGTGTGGTGG + Intergenic
1128592199 15:68909730-68909752 ATCCTCAGTGTGTGGGCTGGTGG - Intronic
1128847458 15:70913232-70913254 AACCTCAGTGTGGTCTCTCTAGG + Intronic
1128933495 15:71726246-71726268 CAGCCCAGTGTGGAGTCTGCAGG + Intronic
1129110757 15:73335795-73335817 CCCCACAGTGAGGAGTCTGGGGG - Intronic
1129414331 15:75366858-75366880 AGCCTGAGTGTGGATTCTGGTGG + Intronic
1130044042 15:80430338-80430360 AACCTAACTCTGGAGTCTGGAGG - Intronic
1130767236 15:86883345-86883367 AAGCTGTGTGTGGATTCTGGTGG - Intronic
1133191929 16:4140152-4140174 AACATCAGTGTGAGGTGTGGAGG + Intergenic
1133638655 16:7695849-7695871 AATCTCAGTGTGGGGTTTGATGG + Intronic
1138241678 16:55432387-55432409 AACCTGAGTGTGAAGTCTTCTGG + Intronic
1138482291 16:57311531-57311553 CACATGAGTGTGGGGTCTGGTGG - Intergenic
1140871747 16:79113165-79113187 AAGCTCAATGTGGAGACTAGTGG + Intronic
1141782717 16:86174665-86174687 AATCTCAGGGTAGAGTCTGTGGG + Intergenic
1141899838 16:86983905-86983927 AAGCTGAGGGTGGAGGCTGGGGG + Intergenic
1146224937 17:31057546-31057568 TTCCTCAGGCTGGAGTCTGGTGG - Intergenic
1148900415 17:50871527-50871549 AACCTCAGTGTGGTTTCCTGTGG + Intergenic
1151535236 17:74735637-74735659 AGCCTCAGACTGGAGTGTGGAGG - Intronic
1152624254 17:81381040-81381062 GTCACCAGTGTGGAGTCTGGGGG - Intergenic
1152888286 17:82865351-82865373 ACCCTCAGCGTGGAGCCTGCCGG - Intronic
1153296984 18:3556068-3556090 AACCTCAGTGTGTTGTCCTGGGG - Intronic
1154409564 18:14130589-14130611 CACTTCAGTGAGGAGTATGGGGG - Intronic
1157821563 18:50775346-50775368 TACCTCAGTGGGCAGGCTGGTGG - Intergenic
1159354430 18:67319295-67319317 AACCTCAGTGTGGAAGGTTGAGG + Intergenic
1159897519 18:74011469-74011491 AACCTCAGGGAGGCTTCTGGTGG - Intergenic
1161851059 19:6738332-6738354 AGCCTCAGTGTGTGGTGTGGGGG - Intronic
1164615755 19:29665903-29665925 AGCCCCAGTCTGCAGTCTGGAGG + Intronic
1164889784 19:31813437-31813459 ATTCTCAGTGTGGAACCTGGGGG - Intergenic
1166624174 19:44334921-44334943 TGCCTCAGTGGGGACTCTGGGGG - Intronic
1166785578 19:45364822-45364844 ATACTCAGTGAGGAGGCTGGTGG - Exonic
1166929773 19:46295337-46295359 ACCCTCAGTGTAGAGGCAGGTGG - Intergenic
1166984743 19:46653008-46653030 GACCTGAGCCTGGAGTCTGGGGG - Exonic
1167299429 19:48670556-48670578 CACCTCCGTGTGGAGTTTGGGGG - Exonic
1167851955 19:52208941-52208963 AGCCTCTCTGTGAAGTCTGGGGG - Intronic
926284397 2:11476625-11476647 AACCTAAGTGTCCAGTCTTGGGG - Intergenic
930285018 2:49416612-49416634 CACCTCACTGTGAAGTTTGGTGG - Intergenic
932688109 2:73890804-73890826 ACCCTCACTGGGGATTCTGGAGG - Intergenic
933397484 2:81752144-81752166 ACCCTCACTGGGGAGTCTGAAGG + Intergenic
934672340 2:96222660-96222682 CACCTGAGTGTTAAGTCTGGTGG + Intergenic
934936217 2:98467315-98467337 AATTTCAGTGTGGAGTTTGGAGG + Intronic
936083251 2:109449391-109449413 AACCTCAACGGGGAGGCTGGAGG + Exonic
938130672 2:128713671-128713693 AACCACATGGTGGAGGCTGGAGG - Intergenic
938337951 2:130515773-130515795 AACATTGGTGTGCAGTCTGGAGG + Intergenic
938351888 2:130604965-130604987 AACATTGGTGTGCAGTCTGGAGG - Intergenic
942728499 2:179037018-179037040 AACCTCCCTGTGGAGACAGGTGG + Intronic
944440610 2:199739893-199739915 AACTTCAGTATGGGCTCTGGAGG + Intergenic
944513937 2:200492143-200492165 AACCTCAGTGTGGAGTCTGGTGG - Intronic
945135501 2:206623339-206623361 AATCTCAGTCTGGAGTGAGGGGG + Intergenic
946130105 2:217600118-217600140 AGCTGCAGTGTGGAGGCTGGGGG - Intronic
947827215 2:233114567-233114589 AGGATCAGTGTGGAGTCTGACGG - Intronic
947879824 2:233497960-233497982 AAGCTCTGTGGGGAGTCTGAGGG - Intronic
949046328 2:241874144-241874166 AGCCTCAGTGTAGCCTCTGGAGG + Intergenic
1169965870 20:11216876-11216898 AAGCTCAGTTTGGAGTCTGGGGG - Intergenic
1172150839 20:32789273-32789295 ATCATCAGTGTGGACTCTGAGGG + Intronic
1173434915 20:43023856-43023878 AACCTCAGTGTGGGGGCCAGAGG - Intronic
1175375519 20:58521094-58521116 GCCCTCAGTGTGGGGCCTGGTGG + Intergenic
1175832635 20:61974610-61974632 ACTCTCTGCGTGGAGTCTGGGGG - Intronic
1176863664 21:14029266-14029288 CACTTCAGTGAGGAGTATGGGGG + Intergenic
1178102335 21:29283331-29283353 AACCCAAGTGGGGAGCCTGGTGG - Intronic
1178852880 21:36227871-36227893 AACCTCGGTGTGTACTCTGAGGG + Exonic
1179172624 21:38984257-38984279 AACCTGGGTGAGGAGTCAGGAGG + Intergenic
1179172637 21:38984367-38984389 AACCTGGGTGAGGAGTCAGGAGG + Intergenic
1181508973 22:23380424-23380446 AAGCACTGGGTGGAGTCTGGAGG + Intergenic
1183450776 22:37893767-37893789 AGCCCCAGGGGGGAGTCTGGAGG - Intergenic
1183896632 22:40974692-40974714 TAGCTCAGTGTGGGGCCTGGCGG - Intergenic
1184783214 22:46659324-46659346 AACCTGAGTGGGGAGGCTGAGGG - Intronic
950670940 3:14525084-14525106 GACCTCTGTGTTGAGTGTGGAGG + Intronic
951334081 3:21399591-21399613 AACCTCAGGGTGGTGTATGCTGG - Intergenic
955541114 3:59977256-59977278 AACCGCAGGCTGGAGTCTGGGGG - Intronic
956214177 3:66831468-66831490 ATGCTCAGTGTGCAGTCTGCAGG - Intergenic
956340170 3:68213543-68213565 AAGCTCCCTGTGGAGTCAGGGGG + Intronic
967725248 3:192856270-192856292 AACCTAAGTGTGGAGTCTCCAGG - Intronic
968910952 4:3476720-3476742 AACCTCAGTGTGGAGTGTCGAGG + Intronic
969345656 4:6568279-6568301 AACCCCAGTGATGAATCTGGTGG - Intergenic
969958543 4:10918237-10918259 AAACACAGTGTGGAGTCATGGGG + Intergenic
971427967 4:26534355-26534377 AGACTCTGTGTGGAGCCTGGAGG + Intergenic
976285423 4:83366403-83366425 AAGCAAAGTGTGGACTCTGGGGG - Intergenic
978011640 4:103692795-103692817 AACCTCAGTGTGAGTTCTGAGGG + Intronic
979208188 4:118067743-118067765 AATGTCAGTGTGGAGGGTGGGGG + Intronic
980702735 4:136454308-136454330 AACCTCAGCCTGGTGTCTGGAGG - Intergenic
983984670 4:174043871-174043893 AACCTCAGTGTTGATATTGGAGG + Intergenic
985355632 4:189116367-189116389 AACCTCACTGAGGAATCTGAAGG + Intergenic
988192520 5:27957740-27957762 CACCTGAGGGTGGAGTATGGGGG - Intergenic
988708209 5:33746238-33746260 AAACTCAATGTGGAGTATGGTGG + Intronic
988976395 5:36520824-36520846 AGTCTTAGTGTGGAGTCTGAGGG - Intergenic
994599570 5:101886007-101886029 ACTGTCTGTGTGGAGTCTGGAGG - Intergenic
994720533 5:103374618-103374640 AATCACAGTGTGGAGGCTGCTGG - Intergenic
995964602 5:117889424-117889446 AACCTCACTGTGCAGTCAAGAGG + Intergenic
996749554 5:126875052-126875074 AGCCCCAGTTTGGAGTTTGGAGG - Intronic
997225235 5:132204864-132204886 AGCCTAACTGTGGAGGCTGGGGG - Intronic
998145394 5:139724962-139724984 ACCATCAGTGTGGATTCTGAAGG + Intergenic
998333803 5:141352401-141352423 GCCCTCAGTGTCGAGGCTGGAGG - Exonic
999837604 5:155391493-155391515 CACTTCAGTATGGGGTCTGGTGG - Intergenic
1001232188 5:169998076-169998098 ATCCTCAGGGAGGAGTCAGGAGG - Intronic
1002166388 5:177350126-177350148 AACAGCAGTGTGGAGGCTCGGGG + Intronic
1003082341 6:3031609-3031631 GACCTCCGTGTGGACTCTGAAGG - Intergenic
1004486800 6:16073707-16073729 CTCCTCAGTGTGAAGTTTGGAGG - Intergenic
1007340562 6:41188658-41188680 AACCACAGGGTGGAGTCAGGAGG - Intergenic
1010436387 6:75836421-75836443 TACCTCAGTTTGGAGACTGCTGG + Intronic
1011802774 6:91036520-91036542 AGCCTCAGTGTGGAGACGGGAGG - Intergenic
1015347735 6:132179785-132179807 ACCCTCAGTGGGGAGCCTGAAGG + Intergenic
1017082507 6:150682947-150682969 AACGTCAGGGAGGAGTCTTGGGG - Intronic
1017937175 6:159015975-159015997 AACCACACTGTGGAGAATGGAGG - Intergenic
1018106011 6:160487094-160487116 ATCCTCAGTGCCGTGTCTGGGGG - Intergenic
1018106527 6:160492625-160492647 ATCCTCAGTGCAGTGTCTGGGGG - Intergenic
1020061626 7:5156805-5156827 AACCTCAGTGTGCAGTTTGATGG + Intergenic
1024455275 7:49599038-49599060 AACATCTGTGTAGAGTCTTGTGG + Intergenic
1027248983 7:76386962-76386984 AACCCCAGTTTGGAGCCTGTTGG + Intergenic
1030813831 7:114009103-114009125 AACATCTGTTTGGAGTCTGCAGG + Intronic
1036045005 8:5130125-5130147 CACCTCTGTGTGGGGTCTGGAGG - Intergenic
1038693375 8:29783053-29783075 AGCCTGAGTGTGGAGCCTCGTGG - Intergenic
1040278265 8:46024900-46024922 AGCCTCTGAGTGGAGTCTGGGGG - Intergenic
1041572290 8:59351338-59351360 GACCTCACTGGGGAGTTTGGGGG - Intergenic
1044973217 8:97639911-97639933 AACATCAGGGTGGGGGCTGGGGG - Intergenic
1049029654 8:140024890-140024912 ATCCTGAGTGTGGAGTTTGTCGG - Intronic
1049388176 8:142354744-142354766 CAGCTCAGTGTGGAGGCTGCTGG - Exonic
1050140124 9:2508992-2509014 AACCTCACTGAGGAGTGTGAAGG - Intergenic
1050496524 9:6248004-6248026 ATACTGAGTGTGGACTCTGGGGG - Intronic
1056635481 9:88328085-88328107 AGCATCAAGGTGGAGTCTGGTGG - Intergenic
1056788754 9:89611608-89611630 AAGCTCAGAGGGGAGTCTTGCGG - Intergenic
1057581080 9:96288449-96288471 AACCTCACTGTGGAGATTGCAGG - Intronic
1057919591 9:99086085-99086107 AACCACAGGGTTGATTCTGGTGG - Intergenic
1058767100 9:108192180-108192202 GACCTGAGTCTGCAGTCTGGGGG - Intergenic
1059433634 9:114264201-114264223 CACCTCAGTGGGGAGTGTGTGGG + Intronic
1060660941 9:125404997-125405019 AGCCTCAGTGGGGGGTCTGAAGG - Intergenic
1061195155 9:129103401-129103423 AACCTCAGCCTAGAATCTGGAGG + Intronic
1061718252 9:132534741-132534763 AACCTCCTTGTGCAGTTTGGAGG - Intronic
1185631004 X:1515781-1515803 AACCTCAGTATGCTGTCAGGAGG + Intronic
1186791947 X:13008237-13008259 CATCTCAGTTTGCAGTCTGGTGG - Intergenic
1187553294 X:20327236-20327258 CACCTCAGTTTGGACCCTGGAGG - Intergenic
1190111004 X:47588832-47588854 CAGCTCAGTGGGGAGCCTGGGGG + Intronic
1192085330 X:68090696-68090718 ATTCTCAGTGTGGAGTTTGTGGG - Intronic
1192950785 X:76014217-76014239 ACCCTCAGTGGGGAATCTGAAGG + Intergenic
1196215540 X:113047757-113047779 AAGCTCTCTGTGGAGCCTGGAGG - Intergenic
1197763407 X:130043481-130043503 CACCCGAGTGTGGAGACTGGAGG + Intronic
1201416454 Y:13752783-13752805 AACCTAAGTATGGGGTTTGGGGG - Intergenic