ID: 944514628

View in Genome Browser
Species Human (GRCh38)
Location 2:200500308-200500330
Sequence GGGTATTCAGTTACAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12182
Summary {0: 1, 1: 10, 2: 535, 3: 7662, 4: 3974}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944514628 Original CRISPR GGGTATTCAGTTACAAAAAG AGG Intronic
Too many off-targets to display for this crispr