ID: 944515665

View in Genome Browser
Species Human (GRCh38)
Location 2:200509831-200509853
Sequence GCGGCCTGGAGACCCCAAAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944515657_944515665 2 Left 944515657 2:200509806-200509828 CCAGAAAGCCCCGCCACGGTCTT 0: 1
1: 0
2: 0
3: 1
4: 64
Right 944515665 2:200509831-200509853 GCGGCCTGGAGACCCCAAATCGG 0: 1
1: 0
2: 1
3: 7
4: 88
944515660_944515665 -7 Left 944515660 2:200509815-200509837 CCCGCCACGGTCTTCCGCGGCCT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 944515665 2:200509831-200509853 GCGGCCTGGAGACCCCAAATCGG 0: 1
1: 0
2: 1
3: 7
4: 88
944515659_944515665 -6 Left 944515659 2:200509814-200509836 CCCCGCCACGGTCTTCCGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 944515665 2:200509831-200509853 GCGGCCTGGAGACCCCAAATCGG 0: 1
1: 0
2: 1
3: 7
4: 88
944515661_944515665 -8 Left 944515661 2:200509816-200509838 CCGCCACGGTCTTCCGCGGCCTG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 944515665 2:200509831-200509853 GCGGCCTGGAGACCCCAAATCGG 0: 1
1: 0
2: 1
3: 7
4: 88
944515655_944515665 20 Left 944515655 2:200509788-200509810 CCGGGAGGAGCTGGGGAGCCAGA 0: 1
1: 1
2: 9
3: 46
4: 603
Right 944515665 2:200509831-200509853 GCGGCCTGGAGACCCCAAATCGG 0: 1
1: 0
2: 1
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944515665 Original CRISPR GCGGCCTGGAGACCCCAAAT CGG Exonic