ID: 944515703

View in Genome Browser
Species Human (GRCh38)
Location 2:200509951-200509973
Sequence GGTGCGGAAGAGCCGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944515703_944515718 -7 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515718 2:200509967-200509989 CCGCACCGGGGGGGTGGGGCGGG 0: 1
1: 0
2: 0
3: 25
4: 459
944515703_944515719 -3 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515719 2:200509971-200509993 ACCGGGGGGGTGGGGCGGGTCGG 0: 1
1: 0
2: 1
3: 73
4: 775
944515703_944515721 20 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515721 2:200509994-200510016 CAGCTTCCCAGACTGACCTGCGG 0: 1
1: 0
2: 2
3: 20
4: 254
944515703_944515716 -8 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515716 2:200509966-200509988 TCCGCACCGGGGGGGTGGGGCGG 0: 1
1: 0
2: 2
3: 29
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944515703 Original CRISPR GGTGCGGAAGAGCCGGGCGC GGG (reversed) Exonic