ID: 944515703

View in Genome Browser
Species Human (GRCh38)
Location 2:200509951-200509973
Sequence GGTGCGGAAGAGCCGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944515703_944515719 -3 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515719 2:200509971-200509993 ACCGGGGGGGTGGGGCGGGTCGG 0: 1
1: 0
2: 1
3: 73
4: 775
944515703_944515716 -8 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515716 2:200509966-200509988 TCCGCACCGGGGGGGTGGGGCGG 0: 1
1: 0
2: 2
3: 29
4: 307
944515703_944515721 20 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515721 2:200509994-200510016 CAGCTTCCCAGACTGACCTGCGG 0: 1
1: 0
2: 2
3: 20
4: 254
944515703_944515718 -7 Left 944515703 2:200509951-200509973 CCCGCGCCCGGCTCTTCCGCACC 0: 1
1: 0
2: 0
3: 29
4: 218
Right 944515718 2:200509967-200509989 CCGCACCGGGGGGGTGGGGCGGG 0: 1
1: 0
2: 0
3: 25
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944515703 Original CRISPR GGTGCGGAAGAGCCGGGCGC GGG (reversed) Exonic
900129117 1:1080167-1080189 GGTGCGGGGGAGCAGGGCTCCGG + Intergenic
900400890 1:2472449-2472471 GGCGCGGAAGAGCCAGGGCCAGG + Intronic
900827334 1:4937237-4937259 GGGGCAGAAGAGGCGGGAGCTGG + Intergenic
900897248 1:5492321-5492343 GCTCAAGAAGAGCCGGGCGCAGG + Intergenic
901234499 1:7660775-7660797 GGCGCGGAGGAGCCGGGCACAGG - Intronic
902470925 1:16647268-16647290 GGTGCTGAAGATCCCAGCGCTGG - Intergenic
902487878 1:16760180-16760202 GGTGCTGAAGATCCCAGCGCTGG + Intronic
903180195 1:21601476-21601498 TGTGCTCCAGAGCCGGGCGCGGG + Intronic
903931105 1:26863074-26863096 GGTGGGGAGGAGCAGGGGGCGGG - Intergenic
904236815 1:29122017-29122039 GCTGCGGAAAACCCGAGCGCGGG - Intronic
904256878 1:29259866-29259888 GCAGCGGCAGAGCGGGGCGCTGG + Exonic
906199490 1:43949899-43949921 GGTGCGGACCAGCCTGGCGGTGG + Exonic
912443550 1:109716370-109716392 GGTGGGGAACAGCCGAGGGCTGG + Intronic
915343518 1:155188731-155188753 GGTGCGGTGGAGCCCGGGGCCGG + Intronic
919465933 1:197921610-197921632 GAAGCGGAAGAGCCCAGCGCTGG + Exonic
920090370 1:203448603-203448625 GCTGGGGAAGAGCGGGGCCCTGG - Intergenic
922749212 1:228062872-228062894 GGTGGGGAGGAGCAGGGCTCTGG - Intergenic
924436786 1:244049191-244049213 GCTGCGGGAGGCCCGGGCGCGGG + Intronic
1063664769 10:8054612-8054634 GGGGGGGAGGAGCCTGGCGCTGG - Intronic
1065589593 10:27251602-27251624 GGAGCGGAAGACCAGGGCTCAGG + Intergenic
1067038013 10:42933467-42933489 GGGGCGGAAGAGCCGAGGGCAGG + Intergenic
1067697939 10:48548895-48548917 GCTGAGGAAGAGCAGGGCTCTGG + Intronic
1069651636 10:70053528-70053550 GGCGCGGAGCAGCCGGGCGGAGG + Intronic
1069849643 10:71396777-71396799 GGTGGGGGAGCGCCGAGCGCGGG + Intergenic
1070560850 10:77565519-77565541 GGTGCTGAAGAGCTGGGGACAGG + Intronic
1072249916 10:93573182-93573204 AGTGAGGAAGAGCAAGGCGCTGG - Intronic
1072670620 10:97426446-97426468 GGTGCGGAGGGGCCGGGTGTGGG + Exonic
1072736953 10:97885642-97885664 GGTGGGGAGGAGGCGGGGGCTGG + Intronic
1073147013 10:101287839-101287861 GGTGGGGAAGTGGCGGGCGGGGG - Intergenic
1076791945 10:132781506-132781528 GGTGCGGCAGAGCCGAGGACGGG + Intronic
1076821589 10:132942489-132942511 AGAGCGGACGAGCAGGGCGCCGG - Exonic
1077102828 11:829751-829773 GGAGGGGCAGCGCCGGGCGCGGG + Intronic
1077551048 11:3200507-3200529 GGTGGTGAAGAGTCGGGCGGGGG - Intergenic
1078246136 11:9574234-9574256 GGCGCGGACGAGGCGGGCGGTGG + Exonic
1082000578 11:47391836-47391858 GGTGCGGCAGAGCGGGGCTCAGG + Intergenic
1083637624 11:64129013-64129035 GGTGAGGTAAAGCCGGGAGCAGG - Intronic
1084046031 11:66568252-66568274 GGTGAGGACGCGCCGGGGGCGGG - Exonic
1085579412 11:77637504-77637526 GGTGCGAAGGAGCCGGGCAAGGG - Intronic
1086106937 11:83157017-83157039 CCTGCGGAAGGGCCGGGGGCGGG + Exonic
1088223225 11:107591219-107591241 GGCGCGGAAGGGGCGGGGGCGGG - Exonic
1088796515 11:113270332-113270354 TGTGTGGAAAAGCCGGGCCCGGG + Exonic
1089242951 11:117097899-117097921 GGCGCCCAGGAGCCGGGCGCGGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1096749711 12:53751231-53751253 GGTGCGGAAGGCCGGGCCGCAGG - Intergenic
1096781797 12:53996099-53996121 GGTGCTGACGAGCCGGGAGCGGG + Intronic
1101640412 12:106582657-106582679 GGTGGGGAAGGGCCGGGAGGGGG + Intronic
1103479268 12:121240742-121240764 CGTGCGGGGGAGCCGGGGGCGGG + Exonic
1103527897 12:121579712-121579734 GGGGCTGAGGGGCCGGGCGCTGG - Intronic
1105801075 13:23903703-23903725 GGCGGGGAAGGGCCGGGCGGCGG - Intergenic
1106883336 13:34156131-34156153 GGAGCACAAGAGCCGGGCGGAGG - Intergenic
1108063394 13:46553854-46553876 GGCGCGGAAGAAGCGGGCCCTGG + Intronic
1113378588 13:109784640-109784662 GATGCGGCAGAGGCGGGTGCGGG + Exonic
1114483319 14:23048284-23048306 CGCGCGGGAGGGCCGGGCGCCGG + Exonic
1114547973 14:23516058-23516080 GGTGCTGAAGAGATGGGGGCAGG + Intergenic
1115752313 14:36505427-36505449 GGGGTGGCAGAGCCGGGCTCAGG + Intronic
1119325112 14:73755237-73755259 GGTGGGGAAGAGCCGGGGCTTGG - Intronic
1122203688 14:100137680-100137702 GGTGGGGCAGAGGCGGGCGCTGG + Intronic
1122480229 14:102042467-102042489 GGTGAGGAAGAGTCGGAAGCAGG - Exonic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1123072358 14:105647983-105648005 GATGCGGCAGAGCCGGCCGTGGG - Intergenic
1123092367 14:105747502-105747524 GATGCGGCAGAGCCGGCCGTGGG - Intergenic
1123500596 15:20877967-20877989 GCTGCGGTAGCGCAGGGCGCAGG + Intergenic
1123557841 15:21451660-21451682 GCTGCGGTAGCGCAGGGCGCAGG + Intergenic
1123594068 15:21888941-21888963 GCTGCGGTAGCGCAGGGCGCAGG + Intergenic
1124147351 15:27139989-27140011 GGTGAGGATGAGCAGGGCCCCGG + Intronic
1126823587 15:52528685-52528707 GGGGCGGGAGCGCCGGGCCCAGG - Intronic
1127103364 15:55588636-55588658 GGCGAGGGAGCGCCGGGCGCGGG - Intronic
1129752817 15:78077678-78077700 GGCGCGGAGGCGCAGGGCGCGGG - Intronic
1131166095 15:90143278-90143300 GGTGTGGAGGAGGCGGGGGCCGG + Intergenic
1132399532 15:101496887-101496909 TGTGAGGCAGAGCCCGGCGCAGG - Intronic
1202966192 15_KI270727v1_random:178832-178854 GCTGCGGTAGCGCAGGGCGCAGG + Intergenic
1132579112 16:677077-677099 GGTGAGGAAGCGCCAGGCGCGGG - Exonic
1132666601 16:1083731-1083753 GGTGCAGCAGAGGCGGGCGCTGG + Intergenic
1132859285 16:2062048-2062070 GGTGGGGAGGGGCCGGGTGCTGG + Intronic
1132932963 16:2468113-2468135 GGAGGCGAAGGGCCGGGCGCAGG + Intergenic
1133332954 16:4987754-4987776 GGTGCGGGAGGGCTGGGCGCGGG + Intronic
1135517610 16:23148924-23148946 GGCGCGGGAGAGGCGGGCGGCGG + Exonic
1141710600 16:85696789-85696811 TGTCCGGAAGAGCCAGGCACAGG + Intronic
1142190620 16:88715691-88715713 GGTGCGGGAGACTCGGGAGCTGG - Exonic
1142210809 16:88807664-88807686 GGTGTGGAGGGGCCGGGCGGAGG - Intronic
1142347448 16:89562966-89562988 TATGCCGAAGAGCCGGGCGTTGG - Exonic
1142727954 17:1830126-1830148 GGTGAGGAGGTGCCGGGGGCTGG + Exonic
1142807683 17:2380035-2380057 GGTGCGGGAGACCCGGGCACGGG + Exonic
1144604555 17:16653465-16653487 GGTTAAAAAGAGCCGGGCGCAGG - Intronic
1144708112 17:17383431-17383453 TATGCCGAAGAGCCGGGCGTTGG + Intergenic
1147390729 17:40107684-40107706 GATGGGGAAGAGCCGAGGGCTGG - Intergenic
1150134804 17:62689823-62689845 GGTGCGGATAAGGCGGGGGCAGG - Intronic
1150282887 17:63939777-63939799 GGTGAGAAAGAGACGGGCGTGGG + Exonic
1150658201 17:67054258-67054280 GGTGTGGAAGCTCCGGGCCCTGG - Intronic
1151837640 17:76593794-76593816 GGTGGGGCAGGGCCGGGAGCCGG + Intergenic
1152352478 17:79791393-79791415 GGTGCGGGAGAGCAGAGTGCGGG - Intergenic
1152409702 17:80117243-80117265 GGTGCGGAGCAGCCGGGTGGGGG - Intergenic
1153227379 18:2909083-2909105 GGTGGGGAAGGGCTGGGCCCAGG - Intronic
1155152845 18:23136036-23136058 GGCGCGGCCAAGCCGGGCGCCGG + Exonic
1155806334 18:30175454-30175476 GGCCCGCAAGAGCCGTGCGCAGG + Intergenic
1156171648 18:34493640-34493662 GGTGCAGAGGAGCCCGCCGCGGG + Intronic
1156479412 18:37426666-37426688 GGTGCGGGAGGGCTGGGGGCGGG + Intronic
1160913101 19:1483816-1483838 GGTGCGGCGGGGCCGGGCGGGGG - Exonic
1161053121 19:2175907-2175929 TGTGCGGAAGAGCCCAGTGCTGG - Intronic
1161316505 19:3619920-3619942 GGTGCAGAGGAGACGGGCCCAGG - Intronic
1161450637 19:4343617-4343639 GGGGCGGAGGCGCGGGGCGCGGG + Intronic
1161542652 19:4861307-4861329 GGTGAGGAAGGGCCGGGACCAGG - Exonic
1162422329 19:10572913-10572935 GGTGAGGAAGGGGCGGGTGCTGG + Exonic
1162810908 19:13163960-13163982 GGTGCGGGAGAGCTGGGGGATGG - Intergenic
1163822821 19:19505864-19505886 GGTTCAGAAGCCCCGGGCGCTGG - Exonic
1164617232 19:29674494-29674516 GAGGCGGAGGAGCAGGGCGCGGG + Exonic
1164937386 19:32224826-32224848 CGGGCGGGAGAGCCGGGCGGTGG - Intergenic
1166381909 19:42359099-42359121 GGCGTGGAAAAGCCGGGGGCGGG - Exonic
1167144386 19:47673118-47673140 GGTGGTGAAGAGCAGGGCTCAGG + Intronic
1167424378 19:49422575-49422597 GCCGCGGAGGAGCCTGGCGCTGG - Exonic
1167440744 19:49507354-49507376 GAGCCGGAAGAGCCGGGCGCCGG - Intronic
1167607602 19:50489742-50489764 GGTGCGGCAGAGAAGGGCCCAGG + Exonic
1167960172 19:53098799-53098821 AGCGCGGAAGACCCGGGAGCTGG + Intronic
1168508448 19:56955563-56955585 GGTGCAGAATGGCCGGGTGCGGG - Intergenic
1202703321 1_KI270713v1_random:4060-4082 GGTGCTGAAGATCCCAGCGCTGG - Intergenic
926202544 2:10812416-10812438 CGTGCGCTGGAGCCGGGCGCGGG - Intronic
929055793 2:37875121-37875143 GGTGGGGGCGAGCTGGGCGCTGG + Intergenic
932699949 2:73985312-73985334 TGTGCGGCTGAGCCGGGCGGGGG + Intergenic
944515703 2:200509951-200509973 GGTGCGGAAGAGCCGGGCGCGGG - Exonic
946403434 2:219480767-219480789 GGTGCGGAAGAGAAGGGGGTGGG - Intronic
946422050 2:219570776-219570798 GGTGCTGACGTGCCGGGCGGGGG - Exonic
947872919 2:233449721-233449743 GATGCAGAGGAGCCTGGCGCAGG - Intronic
948588083 2:239033781-239033803 GGTGTTGAAGAGCCTGGGGCAGG - Intergenic
948824740 2:240568687-240568709 GAGGCGGAAGAGCTGCGCGCTGG - Exonic
948874326 2:240819112-240819134 GGTCCGCAGGAGCGGGGCGCTGG - Intronic
1169065454 20:2692539-2692561 GGAACGGAAGAGCCCGGCGGGGG - Intergenic
1169589439 20:7123996-7124018 GGTGGGGAAGAGCAGGGGACAGG - Intergenic
1171235507 20:23521087-23521109 GGTTCTGAAGAGCCAGGAGCAGG + Intergenic
1172245599 20:33443403-33443425 GGCGCCGCGGAGCCGGGCGCCGG - Exonic
1173981055 20:47224518-47224540 GATGCGGCAGAGCCTGGAGCAGG - Exonic
1175691182 20:61067111-61067133 GGTGGGGAGGAGCAGGGTGCTGG + Intergenic
1176311338 21:5152111-5152133 GGTGGGGAACAGCCGGTCGGTGG + Intronic
1179845712 21:44109924-44109946 GGTGGGGAACAGCCGGTCGGTGG - Intronic
1180074627 21:45456304-45456326 GGTGCAGAAGTGGCGTGCGCAGG - Intronic
1180085838 21:45507473-45507495 GGGGCGGGAGAGTCGGGTGCTGG + Intronic
1180100322 21:45580898-45580920 GGTGGGGATGAGCCGGGAGGAGG + Intergenic
1180649930 22:17369430-17369452 GGGGCGGAGGGGCCGGACGCGGG - Exonic
1180868727 22:19134281-19134303 CGTGTGGCAGAGCCAGGCGCCGG + Exonic
1181086316 22:20441093-20441115 GGTTGGGAGGAGCCGGGCACAGG + Intronic
1183649352 22:39145335-39145357 GCTTCCGAAGAGCCGGGCGCTGG + Intronic
1184315251 22:43682909-43682931 AGTGCGGCAGAGGCAGGCGCTGG + Intronic
1184759506 22:46536802-46536824 GGTTCCGCAGAGCCGGGCACGGG + Exonic
1184775853 22:46622330-46622352 GGAGGGGATGACCCGGGCGCTGG - Intronic
1185067647 22:48640112-48640134 AGAGCCGAAGAGCCTGGCGCCGG - Intronic
1185151405 22:49165546-49165568 GGTGGGGAAGAGCCGCTCACAGG - Intergenic
950487576 3:13282381-13282403 GGCTCGGACGAGCCGGGCGGAGG - Intergenic
954130102 3:48556470-48556492 GGTGTGGCAGAGCAGGGGGCGGG - Intronic
954298510 3:49686975-49686997 GGTGCTGAAGATCCCAGCGCTGG + Exonic
961650462 3:128414347-128414369 GGAGCTGAAGAGCTGGGAGCAGG - Intergenic
962818157 3:139020768-139020790 GGTTGGGACGAGCGGGGCGCAGG + Exonic
963602906 3:147392778-147392800 GGTGCCGGAGACCCGGGCTCAGG - Intronic
963733264 3:148992099-148992121 GCGGCGGAGGAGCCGGGCGGAGG - Intronic
963888894 3:150611774-150611796 GGGGCTGAGGGGCCGGGCGCAGG - Intronic
967884793 3:194325945-194325967 GCTGGGGAAGGGCCGGACGCAGG - Intergenic
968451669 4:678878-678900 GGTGCTGAGGAACCGGGAGCAGG + Intronic
968965574 4:3767555-3767577 GGTGCGGACGGGCAGGGGGCGGG + Exonic
976390405 4:84499398-84499420 GGGGCCGGCGAGCCGGGCGCAGG + Intergenic
977536677 4:98261795-98261817 GGTGCCGGGGAGCCGGGCGGCGG - Intronic
977810090 4:101347593-101347615 GGCGCGCAAGAGGCGGGGGCCGG - Intronic
978361105 4:107931793-107931815 GCTGCGGAGGCGCCGGGCGCGGG + Exonic
979224154 4:118265573-118265595 GGCGCGCAAGCGCCGCGCGCAGG - Intergenic
982678119 4:158399533-158399555 GGTGAGGAAGAGCAGGAGGCAGG - Intronic
983290633 4:165799473-165799495 GGTGCAGGAGACCAGGGCGCCGG + Intergenic
983923453 4:173371303-173371325 GGGGCTGAGGTGCCGGGCGCGGG + Exonic
985535975 5:465972-465994 GGTGCGGCACAGCGGGGCCCAGG + Intronic
985550147 5:528677-528699 GGCGCGGGGGAGCGGGGCGCGGG - Intergenic
986721392 5:10563740-10563762 CGGGCAGAGGAGCCGGGCGCGGG - Intergenic
990456549 5:55994762-55994784 GGTGAGGAGGGGCCGGGTGCTGG - Exonic
992104212 5:73436832-73436854 GGTGAGGAAGGGGCGGCCGCGGG - Intergenic
992365128 5:76083259-76083281 GGTGCTGCAGTGCCGGGCGGCGG - Exonic
996230763 5:121060856-121060878 GATGGGGAAGACCCGGGAGCAGG - Intergenic
996769728 5:127073485-127073507 CGGGCGGAAGTGCCCGGCGCAGG - Exonic
997619033 5:135272907-135272929 TGTGCTGAAGAGCCTGGCTCTGG - Intronic
998148266 5:139742793-139742815 GCTGCGGGGGAGCCGGGCTCAGG + Intergenic
998963126 5:147509545-147509567 GGGGCGGGGGAGGCGGGCGCGGG + Exonic
1003049290 6:2765583-2765605 GCTGCGGCCGCGCCGGGCGCCGG + Exonic
1003293633 6:4804528-4804550 GGGGAGGAAGAGCAGGGCCCTGG - Intronic
1004700014 6:18069888-18069910 GGTGGGGAAGAGCTGAGCTCAGG - Intergenic
1005348192 6:24910481-24910503 GGCGAGGAAGCGCCGGGCCCCGG - Intronic
1011419398 6:87155696-87155718 GCTGCGGGAGAGCCGGGTACCGG + Exonic
1014137531 6:117907163-117907185 GCGGCGGCAGAGCGGGGCGCGGG - Intergenic
1019022451 6:168931191-168931213 GGAGTGGAATAGCCGGGCCCCGG + Intergenic
1019022472 6:168931289-168931311 GGAGTGGAATAGCCGGGCCCCGG + Intergenic
1019022582 6:168931730-168931752 GGAGTGGAATAGCCGGGCCCCGG + Intergenic
1019022631 6:168931926-168931948 GGAGTGGAATAGCCGGGCCCCGG + Intergenic
1019022728 6:168932318-168932340 GGAGTGGAATAGCCGGGCCCTGG + Intergenic
1019022740 6:168932367-168932389 GGAGTGGAATAGCCGGGCCCCGG + Intergenic
1019022831 6:168932759-168932781 GGAGTGGAATAGCCGGGCCCTGG + Intergenic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417290 7:933601-933623 GGTGCTGGAGAGCCGGGGACCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417343 7:933751-933773 GGTGCTGGAGAGCCGGGGACCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417384 7:933871-933893 GGTGCTGGAGAGCCGGGGACCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417447 7:934051-934073 GGTGCTGGAGAGCCGGGGACTGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417518 7:934261-934283 GGTGCTGGAGAGCCGGGGACTGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019989666 7:4682599-4682621 GGTACGGCAGAGCCCGGGGCCGG + Exonic
1020114183 7:5466518-5466540 GGAGAGGAAGAGCCGAGGGCTGG - Intronic
1022539283 7:31121289-31121311 GGTGGGGAAGAGCTGGCAGCTGG + Intergenic
1026845651 7:73697635-73697657 GGTGAGGAAGAGTCGGGCATGGG + Exonic
1031978657 7:128109871-128109893 GGTGGGGAAAAACCGGGCCCTGG - Intergenic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1032403223 7:131638104-131638126 GGTGCTGATGAGCAGGGCGGGGG + Intergenic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1034263976 7:149772748-149772770 GGGGAGGAAGAAGCGGGCGCTGG - Intronic
1034500589 7:151448274-151448296 GGTGCGGAAGCGCGGAGCCCAGG - Intergenic
1035244584 7:157554013-157554035 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244602 7:157554068-157554090 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244620 7:157554123-157554145 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244638 7:157554178-157554200 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244656 7:157554233-157554255 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244674 7:157554288-157554310 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244692 7:157554343-157554365 GGTGCGGCCAGGCCGGGCGCTGG + Intronic
1035595628 8:855067-855089 GGTGGGGAGGAGGCGGGAGCAGG + Intergenic
1036220119 8:6914429-6914451 GGCAAGGAGGAGCCGGGCGCAGG - Intergenic
1037769156 8:21788975-21788997 GGGGCGGAGGAGAGGGGCGCTGG - Intronic
1038540266 8:28385633-28385655 GGCGCGGGAGGGCCGGGCGCGGG + Intronic
1039502823 8:38030686-38030708 GGTGCTGAAGAGCGTGCCGCCGG - Exonic
1041686941 8:60652602-60652624 GGCGCGGGCGAGCCGGGGGCGGG + Intergenic
1046660845 8:116947006-116947028 TGTGAGGAAGAGAAGGGCGCAGG - Intergenic
1048984643 8:139728695-139728717 GGTGGGGAAGGGCCTGGGGCTGG + Intergenic
1049194687 8:141308618-141308640 GGTGCGGAGGGGCCGGGGCCGGG - Intergenic
1049291722 8:141806873-141806895 GGTGCTGCAGAGCTGGGTGCTGG + Intergenic
1049457448 8:142700813-142700835 GCTGGGGAAGGGCCGGGCTCAGG - Intronic
1049682314 8:143924951-143924973 GCAGCAGAAGAGCCTGGCGCAGG - Exonic
1049801257 8:144518345-144518367 GGCCCGGAGGAGCCGGGCGGGGG + Intronic
1053137252 9:35658762-35658784 GGTGCGGGACCGCCGGGCGTGGG + Intronic
1053488228 9:38478307-38478329 GGGGAGGAAGAGCCGTGGGCGGG + Intergenic
1055611808 9:78031693-78031715 GGAGCGGGCGCGCCGGGCGCGGG - Intergenic
1055757766 9:79573209-79573231 GGTTTGGAAGTGCGGGGCGCCGG + Intronic
1059309221 9:113376984-113377006 GGTGCGCAAGCGCCGGGCGGTGG + Intronic
1060945872 9:127569103-127569125 GGTGGGGCGGAGCGGGGCGCCGG - Intronic
1061084158 9:128389641-128389663 GGTGCGGGAGAGAGGGGAGCGGG - Exonic
1061388829 9:130306042-130306064 GGAGGGGAAGAGCCCGGGGCGGG + Intronic
1062286974 9:135777717-135777739 GGTGGGGAGGAGCTGGGAGCAGG - Intronic
1062428636 9:136517230-136517252 GGTGCAGACGACCCGGGGGCAGG + Intronic