ID: 944517006

View in Genome Browser
Species Human (GRCh38)
Location 2:200522280-200522302
Sequence GAGCAGCTCTTAAAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944517006 Original CRISPR GAGCAGCTCTTAAAAGAAGA GGG (reversed) Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
902121968 1:14173904-14173926 GAGCTGCTTTTATTAGAAGAGGG + Intergenic
902582734 1:17418936-17418958 GTGCAGCTCTTTAAAGGAGGTGG - Intronic
907656124 1:56343225-56343247 CAGCAGCTCTGAGAAGAAGGAGG + Intergenic
908820383 1:68079465-68079487 GAGAAAATCTTAAACGAAGATGG - Intergenic
909607605 1:77522511-77522533 GGGCTGCCCTTACAAGAAGACGG + Intronic
909990624 1:82219246-82219268 GAGAAGCTCTTAAAATGAGATGG + Intergenic
911493542 1:98600325-98600347 GAGCAACTCAGAAAAGCAGAAGG + Intergenic
912022864 1:105127806-105127828 GAGCAGATCTCTAAAGAAGTGGG - Intergenic
914733179 1:150390985-150391007 GAGAAGCTCTTAAAAACAGTAGG + Intronic
915442428 1:155953473-155953495 GATCTGCTCTTAAAAGAAATGGG + Intronic
916188604 1:162157246-162157268 GAGCAGCTCATTAAATTAGAGGG + Intronic
920219010 1:204382338-204382360 CTGCAGCTATTAACAGAAGAAGG - Intergenic
920894629 1:210033946-210033968 GAACAGCTTTTTAAAGATGATGG + Intronic
923986650 1:239388711-239388733 TATCAGCTCTTATAACAAGAGGG - Intronic
924641847 1:245840779-245840801 GAGCAGGTCTGAAAGGAAAAGGG + Intronic
924849196 1:247807949-247807971 GATCAGCTTCTAAAAGCAGATGG - Intergenic
1064085468 10:12342887-12342909 GAACAGCTGTTAACAGAAGAAGG - Intergenic
1064135000 10:12742934-12742956 CAGCAGGTGTTAAAAGAGGAAGG + Intronic
1065294407 10:24260734-24260756 GATCATCTCTTAAAAAAAAAAGG + Intronic
1067540696 10:47150175-47150197 GAGCAGGTTTTAACAGTAGAGGG - Intergenic
1068973021 10:62979123-62979145 GACCAGATCTTAAAATAATAGGG + Intergenic
1070485295 10:76924776-76924798 GAGTAGCTCTTACAAGATGGTGG - Intronic
1070671243 10:78378783-78378805 GAGGTGTTCTTAAAAGAAGAGGG + Intergenic
1071964689 10:90840577-90840599 GAACAGTTCTTAAAAGTTGAAGG - Intronic
1072160055 10:92757564-92757586 AAGCAGGTGTTAAAGGAAGAGGG + Intergenic
1072912400 10:99515027-99515049 GAGGAGGTCTTAGAAGGAGAAGG + Intergenic
1072983882 10:100122501-100122523 GAGGAGCTCAGAAAAGCAGAGGG - Intergenic
1074455453 10:113591944-113591966 GAGGCACTCTTAAAAGATGATGG - Intronic
1075159020 10:120006363-120006385 GAGTATTTCTTAGAAGAAGATGG + Intergenic
1076804002 10:132846220-132846242 GAGCAGCTCTGAAAGGGAGCAGG + Exonic
1077376728 11:2208765-2208787 GAGCAGCCCTGAGAAGAAGCTGG + Intergenic
1078077959 11:8178652-8178674 GAGCAACTCTTAAACAATGAAGG + Intergenic
1078352498 11:10605997-10606019 CAGCAGCTCTGAAAAGCAGGTGG - Intronic
1078894073 11:15582601-15582623 AAGAAGATCTTAAAATAAGAAGG - Intergenic
1079158254 11:17968901-17968923 GAGAAGCTCACAAAGGAAGATGG - Intronic
1079166691 11:18050618-18050640 GAGGAACTCCTAAATGAAGATGG - Intergenic
1079348212 11:19671107-19671129 GAGCCTATCATAAAAGAAGATGG + Intronic
1080699991 11:34636709-34636731 GGGAAGCTCTTAAAAGAATAAGG - Intronic
1080820955 11:35806053-35806075 GAGCAGCTATTTAAAGGAGCAGG - Intronic
1081339204 11:41906452-41906474 GAGAAGCTTTTAAAAGAAATAGG - Intergenic
1083045907 11:59734428-59734450 GAGCAGGCCTTAAAAGACAAAGG - Intronic
1085008954 11:73122471-73122493 GAGCAGATCAAGAAAGAAGATGG - Intronic
1086890572 11:92253402-92253424 GAGAACCTCCAAAAAGAAGAGGG - Intergenic
1087672120 11:101119704-101119726 GAGCTGTTCTGAATAGAAGAAGG + Intronic
1087832328 11:102832592-102832614 GAGCAGGTCTTCAAATAACATGG + Intergenic
1089362724 11:117901743-117901765 GAGCAGCTTTTCACCGAAGACGG + Intronic
1090929315 11:131281158-131281180 CGGCAGCTTTTAAAAGAAAATGG - Intergenic
1091511040 12:1126315-1126337 GAGCAGATATGAAAAGAACAGGG + Intronic
1092755704 12:11761449-11761471 GATCATCTCTTTAAAAAAGATGG - Intronic
1095665830 12:44797057-44797079 GAACAGGTATTAAAAAAAGAAGG + Intronic
1095709954 12:45277744-45277766 GAGCAACTCCTGAAAGTAGAAGG - Intronic
1095722631 12:45417402-45417424 CAGCAGCTCTTAAAGGAGGAAGG + Intronic
1097476283 12:60059491-60059513 GAGAAGCTCTAACAAAAAGAGGG - Intergenic
1097515116 12:60594748-60594770 GAACAGCTCTCAAAATGAGAGGG + Intergenic
1100896046 12:99183551-99183573 GAGCATCTCTTGAAACCAGAAGG + Intronic
1101055763 12:100911764-100911786 GAGAGACTTTTAAAAGAAGAAGG + Intronic
1104550561 12:129752949-129752971 GAGAAGCTATTAGAAGAAAAGGG + Intronic
1104776034 12:131390737-131390759 GAGCAGCTGTCCAAAGCAGAAGG - Intergenic
1106614044 13:31310274-31310296 GAACAGCTCTCAACACAAGACGG - Intronic
1106687171 13:32073010-32073032 CAGGAGCACTTAAAAGAAAAAGG + Intronic
1109245880 13:59954365-59954387 GAGCAGCTGTTAGAAGCAAAAGG - Intronic
1109888610 13:68576989-68577011 GAGCAGCTTTTAACAGCAAAAGG - Intergenic
1110662296 13:78071472-78071494 AAGCAGTTTTTAAAAGAATAAGG + Intergenic
1112109555 13:96280949-96280971 GAGCTGCCCTTAAGAGAAGCAGG - Intronic
1112596777 13:100814813-100814835 CAGGAGTTCTTAAAAGTAGAAGG - Intergenic
1112679295 13:101743547-101743569 TATCAGTTCTTCAAAGAAGAGGG - Intronic
1113168790 13:107474051-107474073 GAGCAACACTTGAGAGAAGAAGG - Intronic
1113416586 13:110132953-110132975 GAGCTGCATTTAAAAGGAGAAGG + Intergenic
1113509859 13:110844741-110844763 GAGCAGCTCCTGAGAGCAGATGG - Intergenic
1115105930 14:29762083-29762105 GTGGGGCTCTTGAAAGAAGATGG + Intronic
1116063023 14:39948028-39948050 TAGCAGTCCTTTAAAGAAGAAGG - Intergenic
1116937555 14:50757839-50757861 GAGCAGCTGTTGGAAGAAAATGG - Exonic
1118101346 14:62607017-62607039 GAGCAGTTCTAAAAAGAATCAGG - Intergenic
1121487196 14:94326256-94326278 GAGACGCTCTTAAAAAAAGAAGG - Intergenic
1121939172 14:98053250-98053272 GACCACCTCTTAAAATTAGATGG + Intergenic
1122533152 14:102443138-102443160 GAGCAGCTCTTCCAGGCAGAGGG - Intronic
1123487351 15:20754078-20754100 GAGCATCTCTTAAAATATAATGG - Intergenic
1123543842 15:21323132-21323154 GAGCATCTCTTAAAATATAATGG - Intergenic
1123890040 15:24768469-24768491 GAGCTGCCCTCAAAAGAAGATGG + Intergenic
1124109751 15:26773901-26773923 GAGCAGCTGTTAAAAAAAAAAGG - Intronic
1125508567 15:40281248-40281270 GAGGAGCACAAAAAAGAAGATGG + Intronic
1126355856 15:47795305-47795327 GAACTGCTCTTAAAAGGGGATGG + Intergenic
1127963811 15:63909025-63909047 GTGCAGCCCATCAAAGAAGAAGG - Intronic
1128815396 15:70604506-70604528 CAGCATCTCTCAATAGAAGATGG + Intergenic
1128863339 15:71093060-71093082 CAGCACCTGTGAAAAGAAGAGGG - Intergenic
1129611451 15:77062043-77062065 AAGCAGGTTTTAAAAGCAGAGGG + Intronic
1202952158 15_KI270727v1_random:50259-50281 GAGCATCTCTTAAAATATAATGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1136703787 16:32168664-32168686 GCTCAGCTCCTAGAAGAAGAAGG - Intergenic
1137928743 16:52566404-52566426 GCACAACTATTAAAAGAAGAAGG + Intergenic
1138000467 16:53273730-53273752 GAGCAGCTCCTTCAAGATGAAGG + Exonic
1139679380 16:68549263-68549285 GAGGAGCTTTTAAAAGATGCTGG + Intronic
1140043446 16:71424665-71424687 GAGCAGCTCTTCAAAGCATCTGG + Intergenic
1140643297 16:77002474-77002496 GAGCAGCTGTTAACACAGGAAGG - Intergenic
1141005449 16:80347847-80347869 GAGAAGCTGTTAGAAGAACATGG + Intergenic
1141105515 16:81230296-81230318 GTGCAGCTTTTATAAGAATATGG - Intergenic
1142045731 16:87924148-87924170 GACCAGCTCGGAGAAGAAGAGGG - Intronic
1203066269 16_KI270728v1_random:1021064-1021086 GCTCAGCTCCTAGAAGAAGAAGG + Intergenic
1142698879 17:1647948-1647970 GAGCAGCTCCCTAAAGAAAAGGG + Exonic
1144111450 17:12038447-12038469 GAGAAGCTCTTACAAGGATAAGG + Intronic
1144366998 17:14554184-14554206 GAGCAGGTCTCAGAAGAAGGAGG + Intergenic
1146788212 17:35736034-35736056 GAGCATCACTTAAGAGAAGAGGG - Intronic
1147457879 17:40549862-40549884 GAGCAGCTCTCCACAGAAAAGGG + Intergenic
1149501839 17:57158681-57158703 CAGGAGCTCTTAAAAGCAGAAGG - Intergenic
1149695119 17:58610577-58610599 GAGCAGCTTTTAACACAACAAGG - Intronic
1149812844 17:59694106-59694128 GAGCAGTTCTTTAAAGAAAGAGG - Exonic
1151626414 17:75278674-75278696 GTGCAGCTGTTAAAACAGGAAGG + Intronic
1152219463 17:79054589-79054611 GAGAAAGTCTTAAAAGCAGAGGG + Intergenic
1152934904 17:83130800-83130822 GAGCATCTCTTATATGATGAAGG + Intergenic
1155168620 18:23250539-23250561 GAGCCTTTCTTAAAAGTAGAAGG + Intronic
1156469011 18:37365829-37365851 GATCAACTCTTGAAAGATGATGG + Intronic
1157217032 18:45792810-45792832 GACCAGCTGTTACAAGAGGAAGG + Intergenic
1158960450 18:62583819-62583841 GACCAGCTGTTAAAGGATGAGGG + Intronic
1159348674 18:67241445-67241467 GAGCAGCACTAAAATGAATAAGG - Intergenic
1160671495 19:366611-366633 GAGCAGCTCTTTATGTAAGACGG - Intronic
1166418637 19:42615632-42615654 GAGGAGCGCATTAAAGAAGAGGG - Intronic
1168112655 19:54202596-54202618 GAGTAGATTTTAAAACAAGATGG - Intronic
1168587567 19:57605952-57605974 GAGAAGCTCTTTAAAGTGGATGG + Exonic
1168596170 19:57679466-57679488 GAGAAATTCTTGAAAGAAGATGG + Intergenic
927100362 2:19783380-19783402 CACCAGCTCATAAAAGAAGCTGG + Intergenic
927293532 2:21427548-21427570 TAGCAGCACTGAAAGGAAGAAGG - Intergenic
928353691 2:30587765-30587787 GGACAGCTCTTAAAAAAAAAAGG - Intronic
930221771 2:48753392-48753414 GGGCATCTCTTGAAAGATGAGGG + Intronic
931976253 2:67647025-67647047 GAACAGCTCTCAATAGGAGAGGG + Intergenic
932029424 2:68168186-68168208 GAGGAGCTCTGAATATAAGAGGG + Intronic
932544927 2:72698396-72698418 GAGCATCTCTGTAAAGAAGGAGG + Intronic
933105100 2:78314936-78314958 TAGCAGGTGTTAAAAGAAGAAGG - Intergenic
937294624 2:120802358-120802380 GAGCAGTTCATAAGAGCAGACGG + Intronic
937745056 2:125402660-125402682 GAGTAGATTTTAAAAGGAGAAGG + Intergenic
938985991 2:136576929-136576951 GAGCAGTAGTAAAAAGAAGAGGG - Intergenic
940181587 2:150940138-150940160 GGGCAGCTCTTAAAAATACAAGG + Intergenic
940773918 2:157867128-157867150 GTGTTGCTCTTAAAAGAAAATGG - Intronic
941046483 2:160681601-160681623 GAGCATTTCTCCAAAGAAGATGG - Intergenic
941683052 2:168419971-168419993 GAGCAGAACTTAAAACAAGGAGG - Intergenic
944517006 2:200522280-200522302 GAGCAGCTCTTAAAAGAAGAGGG - Intronic
945198810 2:207261652-207261674 GACCAGCTTTCAAAGGAAGACGG + Intergenic
945216826 2:207442999-207443021 GAGAGGCTGTTAACAGAAGAAGG + Intergenic
947957571 2:234206708-234206730 AAACAGTTCTTAAAAGAATATGG - Intergenic
1169750579 20:8988748-8988770 GAGAAGGTCTTAAAAGCAGCTGG + Intergenic
1169926016 20:10784695-10784717 GACCAGCTCTGAAATGAAGTTGG - Intergenic
1170427333 20:16247750-16247772 GAGGAGCTCCTGAATGAAGAGGG + Intergenic
1171022984 20:21603463-21603485 GAGCAGCTGTTAAAGAAAGGGGG - Intergenic
1174716678 20:52766285-52766307 GAGAAGCCTTTAAAAGAAGATGG - Intergenic
1175040511 20:56045720-56045742 AAGCAGAGCTGAAAAGAAGAGGG - Intergenic
1175134486 20:56812683-56812705 GAGTTGCTATTAAAAGAAGCAGG + Intergenic
1175638125 20:60602554-60602576 GAGCAGTTCTCAGAAGAAGGAGG + Intergenic
1175819118 20:61898990-61899012 CCCCAGCTGTTAAAAGAAGAGGG + Intronic
1177112897 21:17049720-17049742 GAACAGCTCTTGATACAAGATGG + Intergenic
1177125704 21:17191271-17191293 GAACAGCTCTTGACACAAGAGGG - Intergenic
1178642731 21:34358767-34358789 GAGAAAATCTTAAAAGCAGATGG - Intergenic
1180605267 22:17054080-17054102 TGGCAGCTCATAAATGAAGAAGG + Intergenic
1180716937 22:17878161-17878183 AAACAGCGCCTAAAAGAAGAAGG - Intronic
1182243733 22:28938207-28938229 AAGCATGTCTTAAAATAAGATGG - Intronic
1182380816 22:29885390-29885412 GAGCATCTCTTAAAATATAATGG + Intronic
1183027653 22:35077850-35077872 GAGCAGCTTTTAAGACATGATGG - Intronic
1184591316 22:45485189-45485211 AAGCAGCTCTTGAAAGCAAAAGG - Intergenic
949781142 3:7690019-7690041 GAGTTGCTCTTAAAAGATAAAGG + Intronic
950694583 3:14688730-14688752 AAGTAGCTCTTATATGAAGATGG - Intronic
953582071 3:44166486-44166508 GAGCAGGTCTTCAAATAAGGCGG + Intergenic
955870461 3:63432995-63433017 GAGCAGCTTATAAAAGAACGTGG - Intronic
957957984 3:87213784-87213806 GAGAAGTTGGTAAAAGAAGATGG + Intergenic
957995319 3:87681055-87681077 AAGAAGCTTTTAAAAGAAGCTGG + Intergenic
958784702 3:98585371-98585393 GAGCAGCTCTTAATAATAGCGGG - Intronic
959932752 3:112000997-112001019 GAGCAGTTTTTACAAGGAGATGG - Intronic
960009292 3:112815954-112815976 GAAAAGTTCTTTAAAGAAGAAGG - Exonic
961152041 3:124647295-124647317 GAGTAGGTATTAAAGGAAGAGGG - Intronic
962576950 3:136763569-136763591 GAGGAGCTGTGAGAAGAAGAGGG + Intergenic
962616551 3:137132159-137132181 GAGCAGGTCCTAAAGGAAGCTGG + Intergenic
962956757 3:140273913-140273935 GAGCAGCTCACAAAACAACAGGG + Intronic
965441208 3:168717232-168717254 GAGAGGCTCTTAAAAGGACAAGG + Intergenic
965502168 3:169470176-169470198 GAGGAGCTCTTCAAATTAGAAGG + Intronic
965719239 3:171643140-171643162 GAGAGGCTATTAAAAAAAGAAGG + Intronic
965764914 3:172120250-172120272 GAGCTGCCCTTAAAACAGGAAGG + Intronic
966230065 3:177642051-177642073 GAGCAGCTCTAGAAAGAAGAGGG + Intergenic
967931434 3:194693260-194693282 GAGCAGCTCAAGAAAGAGGAAGG - Intergenic
969728386 4:8939229-8939251 GAGCAGCTGGTGAGAGAAGAGGG - Intergenic
970375447 4:15452441-15452463 GGACAGCCCTTAAAAAAAGAAGG - Intergenic
970686491 4:18573453-18573475 AAGCAGCTCTTAAATGCTGAAGG + Intergenic
971160479 4:24128742-24128764 AAGCTGCTTTTAAGAGAAGATGG - Intergenic
971408758 4:26347632-26347654 GAGCAGTTCTTTTAAGAACATGG + Intronic
971471053 4:27027548-27027570 GAGCAGCTCTCACCAGCAGAAGG - Intergenic
972023464 4:34345129-34345151 GAGCAGTTCTCAACAGAAGAGGG - Intergenic
972411615 4:38801063-38801085 GAGTAGCTCTTTAAGGAAGCTGG - Intronic
972926109 4:44009331-44009353 GAGCAGCTCCCAAATGAAGGAGG + Intergenic
973748868 4:53992004-53992026 GAGCAGTGCTTAAAACAAGTTGG + Intronic
975185744 4:71400143-71400165 GAGCTGCCCTTAATAAAAGAAGG - Intronic
977028780 4:91856270-91856292 GAACACTCCTTAAAAGAAGAAGG + Intergenic
977299524 4:95252418-95252440 GGGCTGCTCTTCAGAGAAGAGGG - Intronic
978912818 4:114084566-114084588 GAGCAATTATAAAAAGAAGAGGG - Intergenic
982577054 4:157126079-157126101 GGGCAACTTTTAAAGGAAGAGGG + Intronic
982716476 4:158814102-158814124 CTCCATCTCTTAAAAGAAGAAGG - Intronic
982938097 4:161511829-161511851 GATCAGCTATGAGAAGAAGATGG + Intronic
985202868 4:187502445-187502467 AAGCAGATCTTAGAAGAAGATGG + Intergenic
987960867 5:24806523-24806545 GAGCAGCCCTTTGAAGAAGGGGG - Intergenic
989095111 5:37774712-37774734 GAGTAGCTCTTAAAAAGATATGG - Intergenic
992014955 5:72566321-72566343 GAGAAACTCTTTTAAGAAGAGGG - Intergenic
992751263 5:79864755-79864777 GAGCAGGTGTTAAAAGCAAATGG - Intergenic
992772114 5:80058820-80058842 GAGCTGCTCTAAGAAGACGAGGG - Intronic
998586855 5:143436160-143436182 TAGCAGCTTTTAAAATAAAAAGG - Intergenic
998830761 5:146155880-146155902 GTGCTGCTTTTAAAAGAAAAAGG + Intronic
1000182139 5:158821843-158821865 AAGCAGCTTTTGAAAGATGATGG + Intronic
1001156440 5:169276377-169276399 TAGCAGCTCTTGGAAGAAGATGG - Intronic
1001646132 5:173283743-173283765 GCGCAGCCCTTAAAAGAATGGGG - Intergenic
1004401325 6:15291497-15291519 AAGGAGCGCTTAAATGAAGAAGG + Intronic
1006341688 6:33450770-33450792 GAGAAGGACTGAAAAGAAGATGG + Intronic
1007800413 6:44387698-44387720 GCGCAGATCTTCAAAGCAGAAGG + Exonic
1007909296 6:45497205-45497227 GAGCTGCTTTTAAAAGAGAAAGG - Intronic
1007939186 6:45761446-45761468 GATTAGCTCTTAAGAGAAGCTGG - Intergenic
1008928991 6:56917346-56917368 GAGCAGGTTTTAAACAAAGATGG + Intronic
1009650636 6:66473505-66473527 GAGCAGATTTTAAAAGAATAAGG + Intergenic
1010057110 6:71579321-71579343 GAGCAGTTCTTACCAGAAGCTGG - Intergenic
1010335362 6:74675735-74675757 GAGTAGCTCTTGAAATAAGTGGG + Intergenic
1012469572 6:99555954-99555976 CAGCAGTTCTTATAAAAAGAAGG - Intronic
1012618124 6:101302967-101302989 GAGCAGCTGTGAAATGAGGATGG - Intergenic
1013169338 6:107622185-107622207 CAGCAGCTCTTGAAGGTAGACGG + Intronic
1013324308 6:109029372-109029394 GAGCAATTCTTAAGAGAAGCAGG + Intronic
1013707945 6:112861420-112861442 GAGCAAATCTTGAAAGAAGCTGG + Intergenic
1014593309 6:123299535-123299557 GAGCAGCAAGTAAAAGAAAAGGG + Intronic
1014723372 6:124946785-124946807 TAGCAGCTCATAAAATAATACGG - Intergenic
1015104651 6:129521495-129521517 AAGCACCTTTTTAAAGAAGAAGG - Intergenic
1018043213 6:159943403-159943425 GAGGAGCTCTGAAATGAGGAGGG + Intergenic
1019613784 7:1949660-1949682 GAGCAGCTTTTTAGAGGAGAAGG - Intronic
1021111138 7:16696040-16696062 GAGCAGCCTTCAAAAGCAGAAGG - Intronic
1023736850 7:43242931-43242953 AAGCAGATCTGAATAGAAGACGG - Intronic
1024884344 7:54124679-54124701 GAGTAGCTATCTAAAGAAGATGG + Intergenic
1028973900 7:96890938-96890960 GGGCAGCTCTTAAAACAACTGGG + Intergenic
1034070993 7:148185002-148185024 TAGCAGCTCTTGAAAGATAATGG - Intronic
1034571333 7:151958843-151958865 GAACAGCTCTTGACACAAGAGGG + Intronic
1036508358 8:9377323-9377345 TATCAGATTTTAAAAGAAGATGG + Intergenic
1037413827 8:18626668-18626690 GACCATCTCTCAAAAGAAGAAGG + Intronic
1037449611 8:19003615-19003637 GAGCACATTTTAAAAGAGGAGGG + Intronic
1037539634 8:19858418-19858440 GAAAAGCTCTCAAAACAAGAGGG + Intergenic
1037678180 8:21070506-21070528 GAGCAGGTCTCAAATGCAGATGG - Intergenic
1038592663 8:28854487-28854509 GAGGAGATCTTTCAAGAAGAAGG + Intronic
1038620658 8:29139768-29139790 GAACAGTTCTTATAAAAAGAAGG - Intronic
1041648283 8:60276138-60276160 GAGCAACTCAAAAAAGAGGATGG + Intronic
1042187717 8:66153814-66153836 GACAAGCTCAGAAAAGAAGAGGG + Intronic
1043021061 8:75000314-75000336 GGGCAGCTCTTGAAGGAAGATGG + Intronic
1045159008 8:99515346-99515368 CAGCAGCTTTAAAAATAAGATGG - Intronic
1046180973 8:110647102-110647124 AAACACTTCTTAAAAGAAGACGG + Intergenic
1048689765 8:136948766-136948788 TAGCAGGTCTTAAGAGAAAAAGG + Intergenic
1048692034 8:136977340-136977362 GAACAGCTTTAAAGAGAAGAAGG - Intergenic
1049263491 8:141652602-141652624 GAAAAGCTCTTAAAGGAAAATGG - Intergenic
1049294430 8:141823669-141823691 GACAGGCTCTTCAAAGAAGAGGG + Intergenic
1049940194 9:538071-538093 GGGCAGCACTGAAAAGCAGATGG + Intronic
1050063657 9:1736701-1736723 GAACAGCTATTAAAAGAAAGAGG + Intergenic
1051554876 9:18372164-18372186 GTACAGCACTTAAAACAAGAGGG + Intergenic
1051811660 9:21056158-21056180 GAGCTGCTCTTGAATGAAGTGGG + Intergenic
1053122962 9:35560089-35560111 CAGCAGCTCTTCAAAGAGGCCGG - Exonic
1053303634 9:36969085-36969107 GAGAAGCTCTTGAAAGTGGATGG - Intronic
1053446489 9:38157155-38157177 GAGTAGCTTTTATAAGAAGGGGG - Intergenic
1055029734 9:71761657-71761679 GAGCATCTCTTATGAGAAAAGGG + Intronic
1055293685 9:74812354-74812376 GTGAAGCTCTTAATAGAATATGG - Exonic
1055298493 9:74858630-74858652 GTGTTGCTTTTAAAAGAAGAAGG + Intronic
1055684627 9:78758116-78758138 GAGCAACTCCCAAAAGAAAAAGG - Intergenic
1056101114 9:83301385-83301407 GAGCAACCCTTCCAAGAAGATGG - Intronic
1056888938 9:90471349-90471371 AAGCATCTTCTAAAAGAAGAAGG + Intergenic
1057969051 9:99535972-99535994 GCTCAGATCTTAAAAGAACATGG - Intergenic
1058654606 9:107208406-107208428 GAGCAGGAAGTAAAAGAAGAAGG + Intergenic
1059203252 9:112438568-112438590 GAAAATATCTTAAAAGAAGAAGG + Exonic
1059762279 9:117349577-117349599 AGGCAGCTCTAAAAATAAGATGG + Intronic
1061117582 9:128624345-128624367 GAACATCTCTTCAAAGATGAAGG + Exonic
1186605309 X:11083981-11084003 GAAGAGCTCTTAGAAGAAAATGG + Intergenic
1186694512 X:12015985-12016007 GAGAAACTCTGAAAAGAAAATGG - Intergenic
1186918201 X:14246408-14246430 AAGCAGTTTCTAAAAGAAGAAGG + Intergenic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1188334848 X:28918530-28918552 GAGCAGCTCTTTCAACAAGTTGG + Intronic
1188668835 X:32858288-32858310 AAGCATATATTAAAAGAAGAAGG - Intronic
1189123891 X:38425278-38425300 GAGCAGCACTTCAAAGAAAGAGG - Intronic
1192148992 X:68700272-68700294 GAGCAGCCCTGTAAAGTAGATGG + Intronic
1192502781 X:71664534-71664556 GAGCAGGACTTAACAGAAAAGGG + Intergenic
1192503992 X:71669971-71669993 GAGCAGGACTTAACAGAAAAGGG - Intergenic
1192509982 X:71715914-71715936 GAGCAGGACTTAACAGAAAAGGG + Intronic
1192516715 X:71765639-71765661 GAGCAGGACTTAACAGAAAAGGG - Intronic
1192522743 X:71816035-71816057 GAGCAGGACTTAACAGAAAAGGG - Intergenic
1192529114 X:71871038-71871060 GAGCAGGACTTAACAGAAAAGGG + Intergenic
1194956307 X:100184958-100184980 CAGCTGTTCTAAAAAGAAGATGG - Intergenic
1195992830 X:110699760-110699782 GTGCAGTTGTTAAAAGAATACGG - Intronic
1196488263 X:116239287-116239309 GAGATGCTCTAAACAGAAGAAGG - Intergenic
1196853257 X:119959059-119959081 GAGAAACTCTTAAAAGAAGATGG - Intergenic
1199458624 X:148058153-148058175 GAGCAGTTCTATAATGAAGATGG + Intergenic
1200821627 Y:7590123-7590145 GAACAGCTCTTAACTGCAGAAGG + Intergenic
1202238679 Y:22742631-22742653 GAACAGCTCTTAACTGCAGAAGG - Intergenic