ID: 944518073

View in Genome Browser
Species Human (GRCh38)
Location 2:200532202-200532224
Sequence GACTCAAGGCAGGTAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944518066_944518073 8 Left 944518066 2:200532171-200532193 CCTGGATTGACATAGTGAGCTGA 0: 1
1: 0
2: 0
3: 9
4: 52
Right 944518073 2:200532202-200532224 GACTCAAGGCAGGTAGTGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944518073 Original CRISPR GACTCAAGGCAGGTAGTGGT GGG Intronic
900602681 1:3509761-3509783 GACCCCAGGCAGGTGGGGGTGGG + Intronic
901193827 1:7428595-7428617 GACTCAGGGGAGGATGTGGTAGG - Intronic
902626183 1:17677761-17677783 AAACCAAGGCAGGAAGTGGTGGG + Intronic
903847885 1:26289372-26289394 GCCTCAAGGCAGGTTGGGGGTGG - Intronic
905168092 1:36094996-36095018 AACCAAAGGCAGGTAGTGGCTGG - Intergenic
906508103 1:46394737-46394759 GTGTCAAGGCAGGTGGTGGAAGG + Intronic
906508979 1:46400510-46400532 GACTGGATGCAGGTGGTGGTGGG + Intronic
910277886 1:85467315-85467337 GACTCAGGGCACTGAGTGGTAGG - Intronic
912694868 1:111833785-111833807 TATTCAAGGAAGGTGGTGGTGGG + Intronic
915214211 1:154329154-154329176 GGATCAAGGCAGGTAGGGGGAGG - Intronic
916652248 1:166843246-166843268 AACTCATGGCAGGGAGTGGAAGG + Intronic
922593896 1:226799019-226799041 GGCTGAAGGCAGGTAGAGGCAGG + Intergenic
923654713 1:235905627-235905649 GAGTCAAGGCCGGGTGTGGTTGG + Intergenic
1064008254 10:11714922-11714944 GAGGGAAGGCAGGCAGTGGTTGG + Intergenic
1067165627 10:43864423-43864445 CACCCAAGGCAGGCAGTGGTGGG - Intergenic
1068806465 10:61199745-61199767 GATTTAAGGCAGGAAGGGGTGGG - Intergenic
1073511203 10:104043640-104043662 GACCCAAGCCAGGTTGTGGTGGG + Intronic
1075015251 10:118905874-118905896 GTCTCCAGGCAGGAGGTGGTGGG + Intergenic
1077018891 11:408760-408782 GACTGAAGGCAGGGAGCAGTGGG + Exonic
1077067269 11:647792-647814 GACTCAATCCAGGCAGTGCTGGG + Intronic
1078760312 11:14246088-14246110 GATGAAAGGCAGGTAGGGGTGGG + Intronic
1080438400 11:32267922-32267944 GACTCCAGACAGGAACTGGTGGG + Intergenic
1084918679 11:72451092-72451114 GACAGAAGGGAGGGAGTGGTGGG + Intergenic
1085121171 11:73968539-73968561 GACTGATGGCAGGTGGTTGTGGG - Intronic
1087161663 11:94954147-94954169 GATTTAAGGCAGGAAGGGGTAGG - Intergenic
1088597326 11:111450197-111450219 GACACAAGGGAGGTGGGGGTGGG - Intronic
1090408878 11:126493926-126493948 GACTCAAGGCTGGAATTAGTGGG + Intronic
1092151387 12:6251381-6251403 GACTCTAGGTGGGTGGTGGTGGG - Intergenic
1094501323 12:31023408-31023430 GACTCAGGGCTGTTCGTGGTGGG + Intergenic
1097610819 12:61817832-61817854 GCCTGAAGGTAGGTAGAGGTTGG - Intronic
1101892994 12:108732195-108732217 TCCTCAAGGGAGGTGGTGGTAGG - Intergenic
1103218558 12:119223757-119223779 GACTCAGGGCAGGGAGAGGAGGG - Intergenic
1111398297 13:87697416-87697438 AATTCAAGGCAGGTAATAGTAGG - Intergenic
1111604404 13:90519503-90519525 GAGCCAAGGCAGGAAGTGGCTGG - Intergenic
1116950327 14:50872992-50873014 CACTGAAGCCAGGTATTGGTTGG + Intronic
1117506872 14:56413202-56413224 GACCCAATGCAGATAGTGGGTGG + Intergenic
1118259865 14:64236584-64236606 GACTCAAGGCGAGGTGTGGTGGG - Intronic
1118459401 14:65974944-65974966 AGCTGAAGGCAGGTAGTGGAGGG + Intronic
1121087076 14:91154914-91154936 GACACAAGGCAGGAGGTGGCGGG - Intronic
1121273182 14:92651390-92651412 CTCTCGAGGCAGGAAGTGGTGGG + Intronic
1121583026 14:95044914-95044936 GCCGCAAGGCAGGGAGTTGTGGG - Intergenic
1124076832 15:26454131-26454153 CCCTCAAGGCAGGCACTGGTGGG - Intergenic
1126944926 15:53808926-53808948 CTCTCGAGGCAGGAAGTGGTTGG - Intergenic
1127711572 15:61604409-61604431 GAATCAAGGCAGGTGGCGGTGGG - Intergenic
1133367335 16:5220973-5220995 GACTCATGGAAAGTAGTGATTGG - Intergenic
1135973483 16:27089364-27089386 GACCCAAGGTACATAGTGGTGGG + Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1141948976 16:87328536-87328558 GATTCAAGGCAGGTGGTATTGGG - Exonic
1143986782 17:10921497-10921519 GACTCAGGGCAATTAGTAGTAGG - Intergenic
1145711597 17:26983368-26983390 GACCCACAGCAGGAAGTGGTGGG - Intergenic
1145940732 17:28742192-28742214 GACTGAAGGGAGGAAGGGGTAGG - Exonic
1146290502 17:31603310-31603332 GACTCATGGCAGGTGGAGTTCGG - Intergenic
1149624502 17:58070649-58070671 GAGCCAAGGCAGGGAATGGTGGG - Intergenic
1151668322 17:75558094-75558116 CACTCAAGGCAGGCAGGGGATGG + Intronic
1151801558 17:76382570-76382592 GACTCAAGGCTGGTGGTAGTGGG + Intronic
1153365073 18:4246786-4246808 CACTCAAGTCAGTTAGTTGTTGG + Intronic
1157319365 18:46622524-46622546 GTCTCTAGGCAGGGGGTGGTGGG + Intronic
1157827565 18:50826034-50826056 GAAACAAGGCAGGTGGGGGTGGG - Intergenic
1159668582 18:71195003-71195025 TACTCAAGGCTGTTAGTGGAGGG - Intergenic
1161588421 19:5117839-5117861 GACTCAAGGCAGAAAGCGGGTGG - Intronic
1163420774 19:17212461-17212483 GAGTCAAGGCAGGGAGAGGCCGG + Exonic
1164512300 19:28907563-28907585 GACTCACAGAGGGTAGTGGTGGG - Intergenic
1165877599 19:39020141-39020163 CACTTAAGGCAGGTAGGGATAGG + Intronic
1167492602 19:49801132-49801154 GTCTCAGGGCAGGCAGTGATGGG + Intronic
933573084 2:84036328-84036350 GACTAAAGGAAGGTGATGGTAGG + Intergenic
934859911 2:97755799-97755821 GACTGAAGGCTGGTAAAGGTTGG + Intergenic
941920707 2:170848155-170848177 GACTGAAGGCAGGTAGCTGAGGG - Intronic
944518073 2:200532202-200532224 GACTCAAGGCAGGTAGTGGTGGG + Intronic
946008081 2:216542414-216542436 GACTTGAGGCAGGTAGGTGTGGG + Intronic
946173146 2:217907185-217907207 GAGTGATGGCAGGTGGTGGTGGG - Intronic
946385498 2:219381911-219381933 GCCTCAAGGCAGGTTATGCTTGG + Intronic
947094601 2:226551624-226551646 GACTCCAGGAAGTAAGTGGTTGG + Intergenic
1170475886 20:16714054-16714076 GACTCAAAGCAGGCAGAGCTTGG + Intergenic
1170912353 20:20585679-20585701 GATTCAAGGCAGGAAGTACTGGG + Intronic
1175913314 20:62414696-62414718 GTCCCATGGCAGGTAGTGGAGGG + Intronic
1176264760 20:64203407-64203429 GACTAGAGGCAGGGAGAGGTGGG + Intronic
1176692604 21:9934204-9934226 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1180043053 21:45290109-45290131 GAATCAAGGCAGGTTGCCGTGGG + Intergenic
1180157971 21:45987188-45987210 GACTCACGGCTGGGGGTGGTGGG - Intronic
1182947805 22:34341021-34341043 TACTGAAGCCAGGAAGTGGTAGG - Intergenic
1183705489 22:39472865-39472887 GCCTCAAGGCAGGTATGGGCCGG + Intronic
1184887260 22:47354019-47354041 CACCCCAGGCAGATAGTGGTGGG + Intergenic
1185277263 22:49955177-49955199 GACTCAGGAGAGGTGGTGGTGGG - Intergenic
950494621 3:13326195-13326217 GATTCCAGGCAGGGAGTTGTGGG - Intronic
951277958 3:20712530-20712552 GACTCAAGGCTGGACATGGTGGG + Intergenic
952822639 3:37498458-37498480 GAGTGGAGGCAGGGAGTGGTAGG + Intronic
961826160 3:129600212-129600234 GCCTGAAGGCAGGCAGGGGTGGG - Intronic
963010742 3:140768012-140768034 ATCTCAATGCAGGGAGTGGTTGG - Intergenic
967943045 3:194780908-194780930 GACTCAAGTCAGCTTGTGGCTGG - Intergenic
971171055 4:24233059-24233081 GGCCCAAGGCAGGCAGTGCTGGG - Intergenic
972170225 4:36336594-36336616 GACTTCAGCCTGGTAGTGGTGGG + Intronic
979062848 4:116087350-116087372 CACCCAAAGCAGCTAGTGGTGGG + Intergenic
980365188 4:131794416-131794438 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
981037994 4:140192035-140192057 GTCTCAAGGTAGGTGGTGATAGG + Intergenic
983168923 4:164513586-164513608 GACTGATGGAAGGTAGAGGTAGG + Intergenic
983715150 4:170773313-170773335 GATTTAAGGCAGGAAATGGTAGG - Intergenic
984074903 4:175164224-175164246 GACTTAAGGCAGGAAGAGATAGG - Intergenic
986249612 5:6044407-6044429 CACTCAAGGCAGGTAGCAGTGGG + Intergenic
987252025 5:16109643-16109665 GACCCAAGGCAGGTGGGGGGAGG + Intronic
990946437 5:61254373-61254395 GCCTCAAAGCAGGTAGGGGGCGG + Intergenic
993261755 5:85666560-85666582 GATTTAAGGCAGGAAGAGGTAGG + Intergenic
994156961 5:96514630-96514652 GATCCAAGGCAGGGAGTGCTGGG - Intergenic
995311356 5:110716004-110716026 AACTCAAAGCTGGGAGTGGTGGG - Intronic
995822351 5:116250992-116251014 CACTTAAGGCAGGAACTGGTAGG - Intronic
999349015 5:150849050-150849072 ACCTCAAGGCAAGTAATGGTCGG + Intronic
1001003560 5:168030066-168030088 GACACAGGGCAGGTACTGGATGG + Intronic
1004307045 6:14510416-14510438 CACTGAAGGCAGACAGTGGTTGG - Intergenic
1006137565 6:31904828-31904850 GGCTCAAGACAGGTAGTCCTTGG + Intronic
1007662509 6:43495465-43495487 GACACAGGGCAGGAAGTGGTTGG + Intronic
1007956349 6:45921150-45921172 GACTCATGGCAGGTAAGGGGGGG + Intronic
1011817768 6:91213122-91213144 GACTCTAGGCTAGTACTGGTGGG + Intergenic
1019096692 6:169587069-169587091 GACTTAAGGCAGGAAGGGATAGG - Intronic
1022197488 7:28082905-28082927 GACTGAAGGAAGGCACTGGTGGG - Intronic
1022499735 7:30875105-30875127 GACTCAATGCAGGATGTGGCTGG - Intronic
1023851000 7:44150315-44150337 GAGTCAAGGCAGGGCGTGGGGGG + Intronic
1025809473 7:64866288-64866310 TACCCAAGGCAGGTGGTGGTAGG - Intergenic
1026452734 7:70543622-70543644 AACTGCAGTCAGGTAGTGGTGGG - Intronic
1034737805 7:153445266-153445288 GACTGAAGGCAGGAAGGAGTTGG + Intergenic
1035108394 7:156460709-156460731 GAGTCCAGGCAGGTGGTGGTTGG + Intergenic
1037013496 8:13874460-13874482 GATTAAAGGCAGGAAGTGATAGG - Intergenic
1037806334 8:22059740-22059762 GCCACCAAGCAGGTAGTGGTTGG + Intronic
1038404007 8:27308553-27308575 GATTCAAGGTAGGTGGTTGTGGG - Intronic
1041292993 8:56324963-56324985 GACTCAAGGAAGACAGTGATAGG + Intergenic
1043566231 8:81551515-81551537 GACTTAAGGCAGGGAATGTTTGG + Intergenic
1047221657 8:122923529-122923551 GATTCAAGGGAGGTAGGGATGGG + Intronic
1048113251 8:131490999-131491021 GATTCAAGTCAGGTGGTGATGGG - Intergenic
1049293963 8:141819942-141819964 TACCCAAGGCAGGGAGGGGTGGG + Intergenic
1049294355 8:141823112-141823134 GACTCACGGCATGTCATGGTGGG - Intergenic
1051558669 9:18414032-18414054 GACTCAAGGCAGTGAGATGTTGG + Intergenic
1053629546 9:39920269-39920291 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1053776220 9:41543278-41543300 AACTCAAAGCAGGTGGGGGTGGG + Intergenic
1054214341 9:62330433-62330455 AACTCAAAGCAGGTGGGGGTGGG + Intergenic
1054346318 9:63968766-63968788 GACTCCAGGCTGGTACTGGGGGG + Intergenic
1054365512 9:64335212-64335234 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1054444094 9:65295416-65295438 GACTCCAGGCTGGTACTGGGGGG + Intergenic
1054486177 9:65726089-65726111 GACTCCAGGCTGGTACTGGGGGG - Intronic
1054673143 9:67824925-67824947 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1054904861 9:70405916-70405938 GATTCCAGGTAGGGAGTGGTAGG + Intronic
1058418091 9:104808824-104808846 TGCTCAAGGCTGGTAGAGGTGGG - Intronic
1059336986 9:113575140-113575162 GCATCCAGGCAGGTGGTGGTGGG + Intronic
1060440233 9:123632190-123632212 GAGTCAGGGCAGGTGGGGGTGGG - Intronic
1061322331 9:129839123-129839145 GCTTCAGGGCAGGTAGTCGTGGG + Intronic
1187239449 X:17499432-17499454 GATTTAATGCAGTTAGTGGTGGG - Intronic
1191757366 X:64607928-64607950 GACACTTGGCAGGTAGTGGAAGG + Intergenic
1192820280 X:74637491-74637513 GACTCCAGGCTGGTACTGGGGGG - Intergenic
1194444016 X:93965637-93965659 GACCCAAGGGAGGCATTGGTGGG + Intergenic
1195877033 X:109552288-109552310 AACTCAAGACAGTTAGTGGAGGG - Intergenic
1198411616 X:136375034-136375056 GACTCAAGGGAAAGAGTGGTGGG - Intronic
1198721593 X:139627378-139627400 GACTTAAGGCAGGGAGTGATTGG - Intronic
1200121834 X:153794793-153794815 GACCCACGGCAGGTGGTGTTGGG + Intronic
1200214929 X:154363994-154364016 GACTAAAGGCCGGTGGAGGTTGG + Intronic