ID: 944518217

View in Genome Browser
Species Human (GRCh38)
Location 2:200533859-200533881
Sequence TCTAGGGCCACTCCTTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944518208_944518217 21 Left 944518208 2:200533815-200533837 CCTCCTGGGTGCCTGTAAATCAT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG 0: 1
1: 0
2: 1
3: 5
4: 99
944518209_944518217 18 Left 944518209 2:200533818-200533840 CCTGGGTGCCTGTAAATCATGAT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG 0: 1
1: 0
2: 1
3: 5
4: 99
944518207_944518217 25 Left 944518207 2:200533811-200533833 CCAGCCTCCTGGGTGCCTGTAAA 0: 1
1: 0
2: 1
3: 39
4: 473
Right 944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG 0: 1
1: 0
2: 1
3: 5
4: 99
944518210_944518217 10 Left 944518210 2:200533826-200533848 CCTGTAAATCATGATGCAGCTCC 0: 1
1: 0
2: 1
3: 3
4: 81
Right 944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG 0: 1
1: 0
2: 1
3: 5
4: 99
944518206_944518217 26 Left 944518206 2:200533810-200533832 CCCAGCCTCCTGGGTGCCTGTAA 0: 1
1: 0
2: 1
3: 48
4: 593
Right 944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG 0: 1
1: 0
2: 1
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944518217 Original CRISPR TCTAGGGCCACTCCTTACAC TGG Intronic
900689500 1:3971724-3971746 TCAAGGTCCACTCCCCACACAGG - Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
905697506 1:39986209-39986231 TCTAAGGCCAAACCTTCCACCGG + Intergenic
907335609 1:53697488-53697510 TCTGGGGCCTCCCCTTACCCAGG + Intronic
912529405 1:110309434-110309456 TCTAGGCTCTCTCCTTCCACAGG - Intergenic
912593254 1:110848946-110848968 CCTAAGGCCACTGCTTACCCCGG - Intergenic
914349686 1:146830301-146830323 TCTAGTGGCACTCTTCACACAGG - Intergenic
919761400 1:201100360-201100382 TCTATGGCCACGCCGCACACTGG + Intronic
922950834 1:229557999-229558021 TCCTGGGCCACTCCTAACCCCGG - Intronic
924302300 1:242652037-242652059 TCTAGGGCCCCACCTACCACTGG - Intergenic
1063011212 10:2023453-2023475 AATGGGGCCACTCCTTACAGTGG + Intergenic
1069860210 10:71466094-71466116 TCCAGGGCCACCCCTTGCAGGGG + Intronic
1070747577 10:78943858-78943880 TCTTGGACCAGTCCTTACTCTGG - Intergenic
1074861663 10:117514603-117514625 TCTAGGGCCACACATTCCTCAGG + Intergenic
1078547524 11:12256879-12256901 CCGAGGGCCACTTCTTCCACCGG + Exonic
1089116941 11:116103026-116103048 CCTAGGGCCACTCCTGCCCCTGG + Intergenic
1090743381 11:129687334-129687356 CCTAGGGCTACTCCTTATAAGGG - Intergenic
1098609833 12:72442750-72442772 TTTAGGCCAACTCCTTACATGGG - Intronic
1100223693 12:92534824-92534846 TTTAGTGCCACACTTTACACAGG - Intergenic
1102036267 12:109772100-109772122 TCTAGGGCCAGGTGTTACACTGG + Intergenic
1102159461 12:110756833-110756855 CCTAGAGCCATTCCTTCCACAGG + Intergenic
1102743907 12:115232842-115232864 TCTAGGGCCACTGACCACACTGG + Intergenic
1104322817 12:127767869-127767891 TCTGAGGCCACTCCTGAAACTGG - Intergenic
1104378492 12:128286339-128286361 TCCAGGGCCCCTGCTTAGACAGG + Intronic
1104716790 12:131020814-131020836 TCCAGGGCTGCTCCTCACACTGG - Intronic
1106041414 13:26097092-26097114 GCGTGGGCCCCTCCTTACACAGG - Intergenic
1107323550 13:39215266-39215288 TCCAGGGCCACTACTAACTCAGG + Intergenic
1113664799 13:112134039-112134061 TCTCTGGCCACTGTTTACACCGG - Intergenic
1119980011 14:79069878-79069900 TCTATGGCAACTCCAAACACAGG - Intronic
1120192796 14:81454267-81454289 TCTAGGCCCACCCCTTAGCCAGG - Intergenic
1128378710 15:67095413-67095435 TCTTGAGCCTGTCCTTACACAGG + Intronic
1129454133 15:75667498-75667520 TCCAGGGCCCCTTCTTACCCTGG + Intergenic
1139984349 16:70885245-70885267 TCTAGTGGCACTCTTCACACAGG + Intronic
1142229281 16:88892156-88892178 GCCACGGCCACTCCTTACATGGG - Intronic
1142393542 16:89817602-89817624 TCCAGGGCCTCTACTTACCCAGG - Intergenic
1144653014 17:17018894-17018916 TCCAGGGCCCCTCCCTAGACAGG + Intergenic
1148889026 17:50794434-50794456 ACCAGGCCCACTCCTAACACTGG + Intergenic
1153157738 18:2168102-2168124 TCTAGGCCCAATTTTTACACAGG - Intergenic
1153457043 18:5294415-5294437 TCTAAGGCCACTCCTCTCTCTGG - Intronic
1154305920 18:13230862-13230884 TCCAGGGCGAATCCTGACACAGG + Intronic
1156043876 18:32856424-32856446 TCCAAGGCCAGTCCTCACACTGG + Intergenic
1157694065 18:49706799-49706821 TCTAGAGCCACTCCACACAGTGG - Intergenic
1157774445 18:50381121-50381143 TCTAGGCCCACACCTAACCCTGG - Intronic
1161033857 19:2073065-2073087 TCCAGGGTCACTCCTTGCCCTGG - Exonic
1161163335 19:2772657-2772679 TCTAGGGACCCGCCGTACACTGG - Intronic
1161280679 19:3443957-3443979 TGTAGGGCCCCTCCTGACCCCGG + Intronic
1166374874 19:42322100-42322122 GCTGGGCCCACTCCCTACACGGG - Intronic
1167108683 19:47446338-47446360 TCCCTGGCCACCCCTTACACAGG - Intronic
926496355 2:13592933-13592955 TCCAGGGCCACAGCTTACACAGG + Intergenic
926726046 2:15998879-15998901 TCTAGGGACACTCCCTCCCCTGG - Intergenic
928746312 2:34419668-34419690 TCAAGGGCCAGTCCTTTCTCTGG - Intergenic
930318000 2:49820804-49820826 GCTAAGGCAACTTCTTACACAGG - Intergenic
930664748 2:54090808-54090830 TCCTGGGCCACTCCATGCACGGG + Intronic
944342252 2:198615424-198615446 TCTAGGGCCACTGCTGCAACTGG + Intergenic
944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG + Intronic
944667001 2:201967104-201967126 TAAAGGGCCTCTCCTCACACTGG - Intergenic
945067047 2:205956226-205956248 TCTGGGGCCACTCCAACCACAGG + Intergenic
946562914 2:220933193-220933215 TCTAGGGCCACTTCTTCTGCTGG - Intergenic
947856915 2:233330359-233330381 CCTAGGGCCACTGCTCACCCTGG - Intronic
1180715732 22:17871055-17871077 TCTAGGCCCCCTCATTACTCTGG + Intronic
1184165584 22:42725526-42725548 TCCAGGGGCACCCCTTACCCAGG + Intergenic
953753433 3:45627091-45627113 TCTGGGGCCACTCCATGCCCAGG + Intronic
954468006 3:50668400-50668422 TCTAGGACCACTGCTCACACAGG - Intergenic
958505636 3:94973746-94973768 TCTAGGGCCCCACCCAACACTGG + Intergenic
960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG + Exonic
961361123 3:126367724-126367746 CCAATGGCCAGTCCTTACACTGG + Intergenic
961508038 3:127384439-127384461 TCTAGTTCCACTCTTTACTCTGG - Intergenic
962717309 3:138137743-138137765 GCTGAGGCCACTCCTTCCACAGG - Intergenic
963745508 3:149120404-149120426 TGTAGGACCACTCTTAACACAGG - Intergenic
966049127 3:175592188-175592210 TCTGGAAACACTCCTTACACAGG + Intronic
968644949 4:1735727-1735749 TCAAGGCCGACTCCTTAAACTGG - Exonic
968688844 4:1979361-1979383 TCCAGGGTCAGTCCTCACACGGG - Exonic
968808891 4:2791397-2791419 CCCAGGGCCACCCCTCACACCGG - Intergenic
969076864 4:4586316-4586338 TCTAGGGCCACTGGACACACTGG - Intergenic
971044688 4:22792309-22792331 TCTAGGGCCACTCCTAAGTGGGG - Intergenic
978232691 4:106419632-106419654 TCTAGGGCCCCTTCTTATAAGGG - Intergenic
981666295 4:147230689-147230711 TCTAGGACAACTACTTTCACAGG + Intergenic
985005344 4:185529602-185529624 TCTAGAGCCACACCCCACACCGG + Intronic
986713773 5:10507601-10507623 TCAAGGGCCAGTCCTTTCTCTGG - Intronic
990206017 5:53430325-53430347 TCTATGGCCAGTTTTTACACAGG - Intergenic
993691546 5:91007185-91007207 GCTGGGGCCACTCCTGACCCTGG + Intronic
994755045 5:103784041-103784063 TTTAGGGCAGCTTCTTACACTGG + Intergenic
996010783 5:118479299-118479321 TCTAGGGCCCCACCTGCCACTGG + Intergenic
1001798637 5:174524057-174524079 TCTAGGGACTCTGATTACACTGG + Intergenic
1003029403 6:2589107-2589129 TCTAGGGCCCCTCCCACCACTGG - Intergenic
1003181526 6:3795993-3796015 ACTAGCGGCACTCCTGACACTGG - Intergenic
1016994039 6:149948292-149948314 TCTTGAGCCTCTCCTCACACTGG - Intronic
1018906315 6:168078411-168078433 TCAAGGGCCAGCCCTTTCACTGG - Intronic
1030169375 7:106586178-106586200 TCCAGGGTGACTCCTTACACAGG + Intergenic
1033757088 7:144404146-144404168 TCTAGAGCCACTCCTCAAAGGGG + Intronic
1035042463 7:155939594-155939616 TCTAGAGTCACTCTTTACACTGG + Intergenic
1037387941 8:18363252-18363274 TTTATGGCCAGTTCTTACACAGG + Intergenic
1038450494 8:27636184-27636206 TCTTGGACCACATCTTACACGGG + Intronic
1047577779 8:126177000-126177022 TGTAGAGAAACTCCTTACACTGG - Intergenic
1049331324 8:142055574-142055596 TCTGGGGCCTCTCCTTAGATGGG - Intergenic
1051210344 9:14735619-14735641 TCAAGGGCCACTCCTTCCACTGG - Exonic
1051225582 9:14895736-14895758 TCAAGGGCCACTCATAACTCTGG - Intronic
1052246905 9:26347177-26347199 TCTAGGACCCCACCTTCCACCGG + Intergenic
1053025853 9:34727537-34727559 ACTTGGGACACTCCTTAGACAGG - Intronic
1055127830 9:72739230-72739252 TCTCTGGCCACTACTTACAAGGG + Intronic
1186588453 X:10902116-10902138 TCTAGCACTACCCCTTACACAGG - Intergenic
1186758621 X:12700033-12700055 TTTATGGCCAGTCTTTACACAGG + Intronic
1187219167 X:17307607-17307629 TCTAGGGCCCCACCTACCACTGG - Intergenic
1189179603 X:38991199-38991221 ACTAGAGCCACTCCTTCCTCAGG - Intergenic
1195056002 X:101145432-101145454 TCTAGGGCCAGTATTAACACAGG - Intronic
1195795484 X:108642343-108642365 TCTAGGGCCCCACCTACCACTGG + Intronic