ID: 944519853

View in Genome Browser
Species Human (GRCh38)
Location 2:200554462-200554484
Sequence GGTAATTTATAATCAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 2, 2: 25, 3: 84, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944519853_944519856 14 Left 944519853 2:200554462-200554484 CCTATAGCTGATTATAAATTACC 0: 1
1: 2
2: 25
3: 84
4: 192
Right 944519856 2:200554499-200554521 AAAACAAGACAATTGTCTGTAGG 0: 2
1: 4
2: 1
3: 37
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944519853 Original CRISPR GGTAATTTATAATCAGCTAT AGG (reversed) Intronic
903149925 1:21399635-21399657 GGTGGTTTATAATCAGCTATAGG + Intergenic
904058982 1:27692335-27692357 GGTGGTTTATAATCAGCTATAGG - Intergenic
905810586 1:40909961-40909983 AGTAATTAATAAACATCTATTGG + Intergenic
906859615 1:49345403-49345425 GGCAGTTTATAATCAGCTAGAGG + Intronic
907363616 1:53942469-53942491 TGTAACATATAATCAGCCATAGG - Intronic
908862913 1:68510068-68510090 GGCAGTTTATAATCAGCCATAGG - Intergenic
910794829 1:91087855-91087877 GGCAGTTTATACTCAGATATAGG + Intergenic
912149001 1:106833172-106833194 GGTAAGTTATATTCAGCTTTTGG + Intergenic
912407747 1:109454977-109454999 GATGGTTTATAATCAGCTATAGG - Intergenic
915070892 1:153265593-153265615 CATAATTTATCATCATCTATTGG - Intergenic
915211966 1:154316599-154316621 GGTAGTTTATAATCAGCCATAGG + Intergenic
916954438 1:169817302-169817324 GTTGATTTTTAATCAGCTACAGG - Intronic
917772551 1:178295486-178295508 TGCAACTTATAATCATCTATGGG - Intronic
918589641 1:186226268-186226290 GGTGGTTTATAATCAGCTATAGG + Intergenic
918652972 1:186989004-186989026 GTTAATTTTTAATGAGATATTGG + Intergenic
919169446 1:193935402-193935424 GGTGGTTTATAGTCAGCTATTGG + Intergenic
919304453 1:195812731-195812753 GGTAGTTTGAAATCAGTTATTGG - Intergenic
921499227 1:215880375-215880397 GGTAATTTATAATTAACAATGGG + Intronic
1065384578 10:25122030-25122052 GATGGTTTATAATCAGCTATAGG + Intergenic
1065567064 10:27022536-27022558 GGTAATTTTTAATAAGTTTTGGG - Exonic
1065659142 10:27987629-27987651 TGTATTTTATAATGAGATATAGG - Intronic
1068907361 10:62341888-62341910 GGTGGTCTATAGTCAGCTATAGG - Intergenic
1072159860 10:92755924-92755946 GGTATTGTAGAAACAGCTATTGG + Intergenic
1075989732 10:126825546-126825568 GGCAATTAATAAACAGCTAAGGG + Intergenic
1077927086 11:6692284-6692306 GGCAGTTTATAGTCAGATATAGG + Intergenic
1078051747 11:7971453-7971475 TTTTTTTTATAATCAGCTATAGG + Intronic
1078751313 11:14166549-14166571 GGCAGTTTATGATCAGATATAGG - Intronic
1079226134 11:18606768-18606790 TGTAACTTAAAAGCAGCTATTGG - Exonic
1079235778 11:18688786-18688808 GGCATTATATAATCAGCTGTAGG + Intergenic
1080288475 11:30643404-30643426 GCTGGTTTATAATCAGCCATAGG + Intergenic
1082164805 11:48934047-48934069 GTTTATTTATAATCTGCAATTGG - Intergenic
1082316907 11:50739768-50739790 GATAATTTGTTTTCAGCTATAGG - Intergenic
1083001360 11:59294384-59294406 GGTGGTTTTTAATCAGTTATAGG - Intergenic
1083085711 11:60142473-60142495 GGTCATTTTTAATCAGTTATGGG - Intergenic
1084878371 11:72151127-72151149 GGTGGTTTATAATCAACTATAGG - Intergenic
1085839104 11:79990047-79990069 GCTATTTTATAATCAGCAAAGGG - Intergenic
1087146456 11:94817692-94817714 TGTTTTTTATAATCAGCTATAGG + Intronic
1087674382 11:101142219-101142241 GGTGGTTTATAATCAACTACAGG - Intergenic
1088007880 11:104964199-104964221 GGCAGTTTATAATCAGGTATAGG + Intronic
1088017240 11:105075637-105075659 GGCAGTTTATAATCAGATATAGG + Intronic
1088700284 11:112405455-112405477 GGTAATTTATTATAAGCAATAGG - Intergenic
1090728478 11:129549222-129549244 GATGGTTTATAATCAGCTATAGG + Intergenic
1090851326 11:130573105-130573127 GGTATTTTATTATTAACTATAGG + Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094316547 12:29141871-29141893 GATGGTTTATAATCAGCTATAGG - Intergenic
1094430466 12:30363289-30363311 GGGAGTTTCTAATCAGCTATAGG - Intergenic
1094431131 12:30370419-30370441 GGCAGTTTATAATCAGATATAGG - Intergenic
1094594292 12:31850287-31850309 AATGGTTTATAATCAGCTATAGG + Intergenic
1098204125 12:68088956-68088978 GGTAATCTTTTATCAGGTATAGG - Intergenic
1098436221 12:70470597-70470619 GATAGTTTATAATAAGCTGTAGG + Intergenic
1098528800 12:71517291-71517313 AGGAATTTATGATCTGCTATTGG - Intronic
1099006632 12:77241667-77241689 GGTAATTTAAAATGAAATATTGG - Intergenic
1099402225 12:82214393-82214415 GCTGGCTTATAATCAGCTATAGG + Intergenic
1099521247 12:83666176-83666198 AATGATTTATAATCAGCTTTTGG + Intergenic
1099637531 12:85233505-85233527 GCTAAATTATAATCAGTTTTTGG - Intronic
1101124822 12:101621712-101621734 GGCAATTTAAAATCAACCATAGG + Intronic
1101306879 12:103537060-103537082 AGTAATTGAGAATGAGCTATGGG - Intergenic
1104099245 12:125590635-125590657 GGCAATATATAAACAGCTTTGGG + Intronic
1104431222 12:128718009-128718031 GGTAGCTTAAAATCAGCCATGGG + Intergenic
1105251366 13:18701497-18701519 GGCAATTTATGATCAGCTGGAGG - Intergenic
1105266783 13:18826145-18826167 GGTAATTTTAAATCAGTTTTGGG - Intergenic
1105778465 13:23684640-23684662 GGTGGTTTATAATCAACTACAGG + Intergenic
1107297659 13:38929006-38929028 GGTAATTTTTAATCAGTTTTGGG - Intergenic
1107311667 13:39084893-39084915 GGTGGCTTATAATCAGATATAGG + Intergenic
1108834075 13:54518809-54518831 AGTAAGTTACAATGAGCTATAGG + Intergenic
1109824126 13:67695414-67695436 GATCATTTAAATTCAGCTATTGG + Intergenic
1111385922 13:87527378-87527400 TGTCATTTTAAATCAGCTATTGG - Intergenic
1111602975 13:90497044-90497066 GATAATTTATGTTCAGCTGTTGG - Intergenic
1112485269 13:99814211-99814233 GGCAATTTAAAAGCAGGTATCGG - Intronic
1113845610 13:113388642-113388664 GGTGGTTTATAATCAGCTACAGG + Intergenic
1113855486 13:113442948-113442970 GGAAATGTCTAATCTGCTATTGG + Intronic
1114138085 14:19876501-19876523 GGTAATCTGTAATCATCTTTGGG - Exonic
1115372247 14:32630014-32630036 GGTCATTTAAACCCAGCTATTGG - Intronic
1116263256 14:42658274-42658296 GCTAATATATAATCAGCAATTGG + Intergenic
1116474057 14:45319466-45319488 GGCAATTTATAATCAGATATAGG - Intergenic
1116700983 14:48241608-48241630 GGTTATTTATAAGCAACTAAAGG - Intergenic
1118550301 14:66942449-66942471 GATGGTTTATAATCACCTATAGG - Intronic
1119941353 14:78644665-78644687 GGTAATTTATTTTTAGTTATTGG + Intronic
1120939291 14:89931373-89931395 GGAAATCTATAGTTAGCTATGGG - Intronic
1121003959 14:90475224-90475246 GTGGTTTTATAATCAGCTATAGG + Intergenic
1121388522 14:93553492-93553514 GAAGATTTATAATCAGCTAAAGG - Intronic
1122174035 14:99903399-99903421 GGTGGCTTATAATCAGATATAGG - Intronic
1122483197 14:102060990-102061012 GGTAATTTGTTGGCAGCTATAGG + Intergenic
1123768500 15:23505613-23505635 GATGGTTTATAATCAGCTGTAGG - Intergenic
1124038004 15:26074247-26074269 TGTAATTGATAATCATCTCTGGG + Intergenic
1126090954 15:45051077-45051099 GATAGTTTATAATCAGCTATAGG - Intronic
1126623963 15:50668127-50668149 GGTGGTTTATAATCAGCTATAGG + Intronic
1130837715 15:87667631-87667653 GGCAGTTTATAATCAGATATAGG + Intergenic
1131413984 15:92235762-92235784 CGCAGTTTATAATCAGATATAGG + Intergenic
1131914423 15:97248770-97248792 GGCAGTTTATAATCAGATATAGG - Intergenic
1134775176 16:16846601-16846623 GATAACTTAAAATCCGCTATAGG + Intergenic
1137230281 16:46558604-46558626 TGTAATTCAAAATCAGCTAGGGG + Intergenic
1139929903 16:70517913-70517935 GTTAATTTTTTATCAGGTATAGG - Intronic
1142947599 17:3445859-3445881 GGTAATTTGTAAGCAGCAATGGG - Intronic
1145217453 17:21062574-21062596 GGAATTTTATAATCAGTAATGGG + Intergenic
1147182334 17:38694206-38694228 GTGAATTTAGAATCAGGTATGGG - Intergenic
1149212802 17:54322999-54323021 TGTGATTGATAGTCAGCTATGGG - Intergenic
1149236822 17:54600904-54600926 GTTAATTCATTATTAGCTATTGG - Intergenic
1149483886 17:57026261-57026283 GGTGGTTTGTAATCAGCTATAGG - Intergenic
1150349701 17:64434078-64434100 GATGTTTTATAATTAGCTATAGG + Intergenic
1153100759 18:1466606-1466628 GCTGACTTATAATAAGCTATTGG - Intergenic
1153829445 18:8908671-8908693 GGTGGTGTATAATCAGTTATAGG + Intergenic
1154421624 18:14235321-14235343 GGTAATTTTAAATCAGTTTTGGG + Intergenic
1154437568 18:14358460-14358482 GGCAATTTATGATCAGCTGGAGG + Intergenic
1156972043 18:43168533-43168555 GATGGTTTATAATAAGCTATAGG + Intergenic
1159638627 18:70837058-70837080 GGTAATTTCAAATCAAATATGGG - Intergenic
1164106556 19:22111814-22111836 GATGGTTTATAATCAGCTATAGG - Intergenic
1166402045 19:42489534-42489556 AGCAGTTTATAATCAGCTATAGG - Intergenic
1166900782 19:46060514-46060536 GGTGGTTTGTAATCAGCTATAGG - Intronic
1167839717 19:52105489-52105511 GTTGGTTTATAATCAGCTACAGG + Intergenic
926500440 2:13646095-13646117 GATGGTTTATAATCAGCTCTAGG - Intergenic
926927293 2:18000401-18000423 GATGGTTTATAATCAGCTATAGG + Intronic
928330131 2:30351388-30351410 GATAATTAAAAATCAGCTAGCGG + Intergenic
928931303 2:36627544-36627566 GTGGTTTTATAATCAGCTATAGG - Intronic
930274069 2:49291071-49291093 GATAACTTATTATCATCTATCGG + Intergenic
933444823 2:82366566-82366588 GTGGGTTTATAATCAGCTATAGG - Intergenic
934104604 2:88684083-88684105 GGCAGTTTATAATCAGCTATGGG + Intergenic
935690773 2:105730419-105730441 AATATCTTATAATCAGCTATAGG + Intergenic
937713043 2:124999539-124999561 AGTTAATTATAATCAGCAATTGG + Intergenic
938471078 2:131562376-131562398 GTGGGTTTATAATCAGCTATAGG + Intergenic
938700493 2:133874067-133874089 GGTGGTTTGTAATCAGCTGTAGG - Intergenic
940423035 2:153500685-153500707 GATAGTTTATAATCAGCTATAGG - Intergenic
941877572 2:170449954-170449976 GGCAGTTTATAATCAGATATAGG - Intronic
942011666 2:171769144-171769166 GGAAATTTATAATTTGCTTTAGG - Intergenic
942097241 2:172545407-172545429 GATGGTTTATAATCAGCTATAGG + Intergenic
942328626 2:174797453-174797475 CATAATCTATAATCAGCTTTGGG + Intergenic
944519853 2:200554462-200554484 GGTAATTTATAATCAGCTATAGG - Intronic
945556596 2:211283622-211283644 TGTAATATATATTGAGCTATAGG - Intergenic
946457910 2:219843686-219843708 GGTAAATTAAAATGAGATATGGG - Intergenic
946492194 2:220159561-220159583 GGTAGTTTGTAAACAGATATAGG - Intergenic
947379347 2:229530190-229530212 GGTATTCTATAAGCAGCTACAGG + Intronic
1169429003 20:5519544-5519566 GTGATTTTACAATCAGCTATAGG + Intergenic
1170872169 20:20216111-20216133 GGAAATTTATTATCAGTCATCGG - Intronic
1171441280 20:25165509-25165531 TGTGGTTTATAATCAGCTATAGG - Intergenic
1173751905 20:45483059-45483081 GGTGGTTTATAATCAGCTATAGG - Intergenic
1176693463 21:9945807-9945829 GATGATTTATAATCAGCTATAGG - Intergenic
1176836888 21:13801377-13801399 GGCAATTTATGATCAGCTGGAGG - Intergenic
1176851849 21:13924635-13924657 GGTAATTTTAAATCAGTTTTGGG - Intergenic
1176930875 21:14808485-14808507 GGCAGTTTATAATCAGATATAGG + Intergenic
1177088596 21:16738348-16738370 CCCAATTTATAATCACCTATTGG + Intergenic
1177219688 21:18175630-18175652 TGGAATTTATAATCAGATAAAGG + Intronic
1177495730 21:21888894-21888916 GGTAATTTATAATCTTTTAATGG - Intergenic
1177639565 21:23829457-23829479 AGTAATGTATAATCAGATTTTGG - Intergenic
1182107706 22:27701061-27701083 GGGAATTTATAACCAGCCATTGG + Intergenic
1183325648 22:37191112-37191134 GGTGGTTTATAATCAGCTATAGG - Intronic
949998012 3:9634096-9634118 GGCAGTTTATAATCAGATATAGG - Intergenic
951255966 3:20449661-20449683 GATGGTTTATAATCAGCTATAGG - Intergenic
951821946 3:26823613-26823635 GATGGTTTATAATCAGCTATAGG + Intergenic
953416346 3:42721297-42721319 GGTGGTTTATAATCAACTACAGG + Intronic
953613359 3:44467013-44467035 GGCAGTTTATAATCAGATATAGG + Intronic
954598002 3:51843604-51843626 GATGGTTTATAATAAGCTATAGG - Intergenic
954651113 3:52163580-52163602 TGTTTTTTATAATCAGCTATAGG + Intergenic
955036319 3:55271597-55271619 GGAACTTTATAATCAGGTAGAGG - Intergenic
955613086 3:60778325-60778347 GATGGTTTATAATAAGCTATAGG + Intronic
955870505 3:63433496-63433518 AGTAATACATAATCAACTATTGG + Intronic
956415721 3:69026899-69026921 GGTAATTTAAATTTACCTATCGG + Intronic
957649841 3:82985879-82985901 GGTAATTTCACATCAGCTAGTGG + Intergenic
957716250 3:83932950-83932972 TATGGTTTATAATCAGCTATAGG + Intergenic
957726071 3:84068880-84068902 GGCAGTTTATAATCAGATATAGG - Intergenic
958592293 3:96173581-96173603 AATAGTTTATAATCAGCTATAGG + Intergenic
960438893 3:117662431-117662453 AGTAATTTATACACATCTATTGG - Intergenic
960453763 3:117843902-117843924 GTTAATTCATAATCAGCAAAGGG + Intergenic
962533279 3:136303544-136303566 GGTATTTTAAAATCAGGTTTTGG + Intronic
963251516 3:143108244-143108266 TATGGTTTATAATCAGCTATAGG + Intergenic
963458354 3:145575539-145575561 GTTGTTTTATAATCAGTTATAGG - Intergenic
963637304 3:147815144-147815166 GGAATTTTATAATTATCTATTGG - Intergenic
963650048 3:147968088-147968110 GGTTCTTTATAAACAGATATAGG - Intergenic
964332292 3:155617237-155617259 GATGGTTTATAATTAGCTATAGG + Intronic
964856056 3:161146837-161146859 GGCAGTTTATCATCAGCTGTAGG + Intronic
964970036 3:162548809-162548831 GGCAGTTTATAATCAGATGTAGG - Intergenic
965205411 3:165714481-165714503 GATAGTTTATAATCAGTTATAGG - Intergenic
966935021 3:184701189-184701211 GGAAGTTTATAATCAAATATAGG - Intergenic
967688871 3:192449787-192449809 AATAATTCATAATCAGCCATGGG + Intronic
970267216 4:14301515-14301537 GGAAATTTATTATAAGGTATTGG - Intergenic
970711904 4:18873826-18873848 GGTGGTTTATAATCAGCTATAGG - Intergenic
970976039 4:22044204-22044226 GGTAACTTAAAATCAGCAATAGG + Intergenic
971593222 4:28496038-28496060 GGTAATTTGTAAGAATCTATTGG - Intergenic
972664805 4:41154756-41154778 GGTAATTTTTAATCAGTTTTGGG - Intronic
972853483 4:43077703-43077725 GTGGGTTTATAATCAGCTATAGG - Intergenic
972971375 4:44580607-44580629 GATAATTTATAAGCAACTAAAGG + Intergenic
973776826 4:54250704-54250726 GGTGGTTTATAATCAGCTATAGG + Intronic
974072608 4:57138438-57138460 GCAGTTTTATAATCAGCTATGGG - Intergenic
975412351 4:74068412-74068434 GGTGGTTGGTAATCAGCTATAGG - Intergenic
976114058 4:81707979-81708001 AGTAACTTATAATCAGCAGTTGG - Intronic
977005172 4:91558931-91558953 GGTAATTTCTCATCAGCTATGGG + Intronic
977527451 4:98162361-98162383 GGTGGTTTATAATCAGATATAGG + Intergenic
977907334 4:102493158-102493180 GATAATTTATAATACGCCATTGG + Intergenic
979591450 4:122485028-122485050 TGCAATTTATAATCAGATATAGG - Intergenic
980225202 4:129974582-129974604 GGTGATTTAAAATCACCTATTGG - Intergenic
980366081 4:131806048-131806070 GATGATTTATAATCAGCTATAGG - Intergenic
982399426 4:154950205-154950227 GATGGTTTATAATCAGCTATAGG - Intergenic
982602863 4:157473621-157473643 CATGGTTTATAATCAGCTATAGG + Intergenic
982606703 4:157525072-157525094 GATGGTTTATAATCAGCTATGGG - Intergenic
982864385 4:160491769-160491791 AGTGGCTTATAATCAGCTATAGG + Intergenic
983262507 4:165472313-165472335 TGGCCTTTATAATCAGCTATAGG - Intronic
984400598 4:179258970-179258992 GGTGGTGTATAATCAGCTATAGG - Intergenic
985339375 4:188932856-188932878 GGCAGTTTATAATCAGATATAGG + Intergenic
988087749 5:26493373-26493395 CACCATTTATAATCAGCTATAGG + Intergenic
988295378 5:29353340-29353362 GGTGGTTTATAATCAGCCATAGG + Intergenic
988361124 5:30237947-30237969 GATGGTTTATAATCAGCTATAGG + Intergenic
989575988 5:42989082-42989104 GGTCGTTTATAATTAGCTATTGG - Intergenic
990070670 5:51778883-51778905 GGTGGTTTATAATAAGCTATAGG - Intergenic
990206336 5:53433546-53433568 GGTAATTTCTACTCAGGTCTGGG + Intergenic
990692635 5:58380678-58380700 GTTGGTTTATAATCAGCTATAGG + Intergenic
991265041 5:64707966-64707988 GGTGGTTTATAATCAGCTGTAGG - Intronic
993120740 5:83771306-83771328 GGCAGTTTATACTTAGCTATAGG + Intergenic
993422166 5:87715937-87715959 GGCAGTTTATAATCAGATATAGG - Intergenic
993600626 5:89919622-89919644 GGTGGTTTATAATCAGTGATGGG - Intergenic
994273009 5:97804151-97804173 GATGGTTTATAATCAGCTATAGG - Intergenic
994897857 5:105727679-105727701 GGTAAATTATAATAACCTAGTGG + Intergenic
996057387 5:118996592-118996614 GGTGGTTTATAATCAGCTATAGG - Intergenic
996795115 5:127337315-127337337 GGTTATTTCTAATCATTTATAGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1000741061 5:164970636-164970658 GATTATTTATAATCAGCTATAGG - Intergenic
1004243317 6:13948254-13948276 GGCAGTTTATAATCAGTTATAGG - Intronic
1006572858 6:35019702-35019724 ACTAATTTACAGTCAGCTATAGG + Intronic
1009717010 6:67410787-67410809 GGCAGTTTATAATCAGCAATAGG + Intergenic
1009759178 6:67981118-67981140 GGTGACTTATAATCAGATAACGG - Intergenic
1010562411 6:77366998-77367020 GGTAGTTTATAATCAACCTTTGG - Intergenic
1011285981 6:85723595-85723617 AGCAGTTTATAATCAGCCATGGG - Intergenic
1011893796 6:92199302-92199324 GCTATTTCATAATCAGCTGTGGG + Intergenic
1013546495 6:111162998-111163020 GATGGTTTATAATCAGCTATGGG - Intronic
1013684904 6:112568610-112568632 GTTAATTAATAAACATCTATAGG - Intergenic
1014097410 6:117475541-117475563 GATAGTTTATAGTCAGCTATAGG - Intronic
1016108611 6:140193185-140193207 GATGGTTTATAATCTGCTATAGG + Intergenic
1016162232 6:140896168-140896190 GATGGTTTATAATGAGCTATAGG - Intergenic
1016205959 6:141468666-141468688 GACAGTTTATAATCAGCTATAGG - Intergenic
1017343581 6:153354742-153354764 GATGGTTTATAATGAGCTATAGG + Intergenic
1018357392 6:163032414-163032436 GGTGGTTTGTAATCAGCTATAGG - Intronic
1019076411 6:169391953-169391975 GATGGTTTATAATCAGTTATAGG - Intergenic
1022325622 7:29328981-29329003 GGTAGTTCATAATCAGTTAATGG - Intronic
1023587552 7:41746616-41746638 GGTCATTTATAATCAGCTATAGG - Intergenic
1023707469 7:42956548-42956570 GCGGATTTATAATCAGCTATAGG - Intergenic
1023800570 7:43830574-43830596 GGTAGTTTATAATCAGATACAGG + Intergenic
1024146976 7:46527286-46527308 GGTGATTTATAATCAGCTACAGG + Intergenic
1024428478 7:49258106-49258128 AGTACTTTATAATCAGTTATTGG + Intergenic
1024484027 7:49895650-49895672 AGTAATTAATTATCAGCCATAGG + Intronic
1025264533 7:57444083-57444105 GGTGATTGATAATCAGCTATAGG - Intergenic
1025634615 7:63311336-63311358 GGTGATTTATAATCAGGTTTAGG + Intergenic
1025648081 7:63436834-63436856 GGTGATTTATAATCAGGTTTAGG - Intergenic
1025741388 7:64199714-64199736 GGTGATTTATAATCAGCTATAGG - Intronic
1026791663 7:73336585-73336607 GGTAGTTTGAAATCAGCTCTGGG + Intronic
1027733490 7:81904452-81904474 GGTAATTTATAAACAGAAAGAGG + Intergenic
1027733750 7:81906947-81906969 GGTAATTTATAAGCAGAAAGAGG - Intergenic
1028146424 7:87324860-87324882 GATGGTTTATAATCAGCTATAGG - Intergenic
1028478852 7:91282475-91282497 GGTAACTTGTAATATGCTATGGG + Intergenic
1030155738 7:106452825-106452847 GGTGGCTTATAATCAGCTTTAGG - Intergenic
1030417911 7:109268427-109268449 GATAATTTGTAATCTGCTCTTGG + Intergenic
1030992313 7:116315237-116315259 CTTGTTTTATAATCAGCTATTGG + Intronic
1031671986 7:124560266-124560288 GGTAAATCATAATCTGCTAAGGG + Intergenic
1032447056 7:131993208-131993230 GGTAATTTATAAACAAAAATAGG - Intergenic
1032573250 7:133024337-133024359 GGTAATTCACAGTCAGCTTTGGG + Intronic
1032611454 7:133419766-133419788 GGTAATTTGTAGGCAGCCATAGG - Intronic
1033053171 7:138025104-138025126 GCAGTTTTATAATCAGCTATAGG + Intronic
1033161832 7:139004236-139004258 GGTGGTTTATAATTGGCTATTGG + Intergenic
1034731908 7:153394845-153394867 GTAGTTTTATAATCAGCTATAGG + Intergenic
1040417856 8:47211515-47211537 GGTGGTTTAGAATCAGCTATAGG - Intergenic
1040990562 8:53345421-53345443 GATGGTTTATAATGAGCTATAGG + Intergenic
1041267780 8:56081883-56081905 GGTAATTTGTTATCAGCAATAGG + Intergenic
1041810205 8:61900326-61900348 GTGGTTTTATAATCAGCTATAGG - Intergenic
1041911962 8:63098313-63098335 GTTGGTTTATAATCAGCTATAGG + Intergenic
1043774484 8:84247693-84247715 GGTACTTTATTATAAGCTCTTGG - Intronic
1044439431 8:92206094-92206116 GGTGGTTTATAGTCAGCTATAGG - Intergenic
1044817072 8:96124270-96124292 GGTAATTTAGAATCTGCTTATGG + Intergenic
1045228649 8:100277680-100277702 GGCAATTTATAATCAGCAATGGG + Intronic
1045428451 8:102090380-102090402 GGTGGTTTATAATCAGCTACAGG + Intronic
1045956833 8:107917931-107917953 GGTGGTTTAGAATCAGCTATAGG + Intronic
1046387433 8:113522604-113522626 GTGGTTTTATAATCAGCTATAGG + Intergenic
1047581445 8:126220340-126220362 GATGGTTTATAATCAGCTATAGG - Intergenic
1049041743 8:140117347-140117369 GGTAATTTATAAGGAGCAACTGG + Intronic
1049505961 8:142998456-142998478 GTGGTTTTATAATCAGCTATAGG - Intergenic
1049922115 9:374788-374810 TGTAATTTAAAATCATCTAGTGG - Intronic
1051225479 9:14894416-14894438 GGTAGCTTATAATCAGCTATAGG + Intronic
1051680659 9:19604518-19604540 GCTAATTTATATCCAGCTATTGG + Intronic
1052071808 9:24090964-24090986 GGTAAAATATAATCAGGAATAGG - Intergenic
1052137802 9:24937061-24937083 GGAAATTTAAAATCTGCTAGTGG + Intergenic
1053191465 9:36073948-36073970 TGTAACTTAAAATCAGCCATGGG + Intronic
1053630426 9:39931893-39931915 GATGATTTATAATCAGCTATAGG - Intergenic
1053775346 9:41531615-41531637 GATGATTTATAATCAGCTACAGG + Intergenic
1054213461 9:62318809-62318831 GATGATTTATAATCAGCTATAGG + Intergenic
1055011087 9:71566342-71566364 AAAAATATATAATCAGCTATGGG + Intergenic
1056427776 9:86494422-86494444 GGTGATCTATAATCACCTCTAGG - Intergenic
1060111259 9:120908465-120908487 TGTAACTTAAAAGCAGCTATTGG - Intronic
1186428146 X:9481107-9481129 GTGGTTTTATAATCAGCTATAGG + Intronic
1189086337 X:38028777-38028799 GGTGGTTTATAGTCAGCTAAAGG - Intronic
1190490814 X:50981201-50981223 GATGGTTTATAATAAGCTATAGG + Intergenic
1190540842 X:51476643-51476665 GCCATTTTATAATCAGCTGTAGG - Intergenic
1190920709 X:54849493-54849515 GGTGGTTTCTAATCAGCTATAGG - Intergenic
1190951605 X:55150717-55150739 GTGGTTTTATAATCAGCTATAGG + Intronic
1192542438 X:71985865-71985887 GGTGGTTTATAATCAGCTACAGG - Intergenic
1193534936 X:82702769-82702791 GGTAATTTATACTTACTTATAGG + Intergenic
1193856469 X:86609991-86610013 GGGAATTTACAATCAGCAGTTGG + Intronic
1194227317 X:91277406-91277428 GATGGTTTATAATCAGCTATAGG - Intergenic
1194447363 X:94005038-94005060 GGTATTTTATAATGAAGTATTGG + Intergenic
1194810032 X:98377965-98377987 GATGGTTTATAATAAGCTATGGG - Intergenic
1195048308 X:101074691-101074713 GGCAGTTTATAATCAGATATAGG + Intergenic
1195263637 X:103159227-103159249 TGTAACTTATACTCAGATATAGG - Intergenic
1196162096 X:112496799-112496821 GGTGGTTTATAATCAGCTATAGG - Intergenic
1196267854 X:113673396-113673418 GGTAAACAATAATCAGTTATAGG - Intergenic
1197244407 X:124153454-124153476 GGCAGTTTATAATCATCTATAGG - Intronic
1197509457 X:127353372-127353394 GATGGTTTATAATCAGCTACAGG + Intergenic
1197552863 X:127916334-127916356 GGTGATTTGGAATCATCTATAGG + Intergenic
1198939489 X:141937622-141937644 GGTGGTTTATAATAAACTATAGG + Intergenic
1200276915 X:154741915-154741937 GGTAATTGATAATCAGATTATGG - Intronic