ID: 944520984

View in Genome Browser
Species Human (GRCh38)
Location 2:200566717-200566739
Sequence GCGGCTAGGAAGCTTGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 2, 3: 86, 4: 734}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944520984_944520990 11 Left 944520984 2:200566717-200566739 CCGGCTTCAAGCTTCCTAGCCGC 0: 1
1: 0
2: 2
3: 86
4: 734
Right 944520990 2:200566751-200566773 ACTCAAGCCTCAGCAATGGCGGG 0: 373
1: 643
2: 583
3: 805
4: 2150
944520984_944520987 7 Left 944520984 2:200566717-200566739 CCGGCTTCAAGCTTCCTAGCCGC 0: 1
1: 0
2: 2
3: 86
4: 734
Right 944520987 2:200566747-200566769 ACCTACTCAAGCCTCAGCAATGG 0: 1335
1: 1630
2: 1504
3: 1312
4: 2555
944520984_944520989 10 Left 944520984 2:200566717-200566739 CCGGCTTCAAGCTTCCTAGCCGC 0: 1
1: 0
2: 2
3: 86
4: 734
Right 944520989 2:200566750-200566772 TACTCAAGCCTCAGCAATGGCGG 0: 1046
1: 1343
2: 949
3: 788
4: 2278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944520984 Original CRISPR GCGGCTAGGAAGCTTGAAGC CGG (reversed) Intronic
900267649 1:1767024-1767046 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
902801360 1:18832121-18832143 GCTGCTGGGAAGCTCAAAGCAGG - Intergenic
903992806 1:27286115-27286137 GCTGCTCGGAAGGTTGAAGCAGG - Intronic
904481525 1:30796940-30796962 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
904898448 1:33836510-33836532 GCGGCTGGGAAGCTCGAACTGGG - Intronic
905039677 1:34945494-34945516 GCTACTTGGAAGGTTGAAGCAGG + Intergenic
905962878 1:42059722-42059744 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
906374602 1:45285038-45285060 GCGGCCAGGAAGCTCGAACTGGG + Intronic
907231700 1:53005117-53005139 GTGGCTGGGAAGCTTGAACTGGG + Intronic
908099717 1:60778180-60778202 GCGGCCTGGAAGCTTGAACTGGG - Intergenic
908913719 1:69102177-69102199 GCGGCCAGGAAGCTCTAAGTGGG - Intergenic
909807902 1:79894252-79894274 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
910339336 1:86167990-86168012 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
910381321 1:86629995-86630017 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
910618817 1:89230439-89230461 GCGGCCAGGAAGTTTGAACTAGG - Intergenic
910785931 1:90998040-90998062 GCGGCCAGGAAGCTCGAACTGGG + Intronic
912317413 1:108678824-108678846 GCTACTAGGGAGGTTGAAGCGGG - Intergenic
912425625 1:109587169-109587191 GCTACTTGGAAGCTTGAGGCAGG + Intronic
913299729 1:117358226-117358248 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
913337385 1:117721149-117721171 GCAGCTGGGAAGCTCGAAGTGGG + Intergenic
913511550 1:119567247-119567269 GCTGCTTGGAAGGCTGAAGCAGG - Intergenic
914441519 1:147711709-147711731 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
915437032 1:155915229-155915251 GCGGCTTGGAAGGCTGAGGCAGG - Intronic
915570207 1:156741207-156741229 GCCGCTAGAAAGCTGGAAACAGG + Intronic
915734687 1:158077396-158077418 GAGGCTGGGAAGCAAGAAGCGGG + Intronic
915872350 1:159574608-159574630 GCAGCTAGGAAGCTCGAACTGGG - Intergenic
915886811 1:159730919-159730941 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
915949944 1:160182781-160182803 GCTGCTTGGAAGGCTGAAGCAGG - Intronic
916154659 1:161832749-161832771 GCAGCTGGGAAGCTTGAACTGGG + Intronic
916543832 1:165783653-165783675 GCGGCCAGGAAGCTCGAACTGGG - Intronic
916769965 1:167898486-167898508 GCGACTCGGAAGGTTGAGGCAGG + Intronic
917181455 1:172302359-172302381 GCAGCTGGGAAGCTTGAAGTGGG + Intronic
917316009 1:173726240-173726262 GCGGCTGGGAAGCTCGAACGTGG + Intronic
917624802 1:176834857-176834879 GCTGCTCGGGAGGTTGAAGCAGG + Intronic
917764132 1:178198973-178198995 GCGGCCAGGAACCTTGAACTGGG - Intronic
917983766 1:180294004-180294026 GCTGCTCGGGAGCCTGAAGCAGG - Intronic
918277166 1:182964343-182964365 GCTGCTCGGAAGGCTGAAGCCGG + Intergenic
918537193 1:185586862-185586884 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
918593136 1:186262238-186262260 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
919065478 1:192688373-192688395 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
920161642 1:204003037-204003059 GAGGCTACTAAGCCTGAAGCAGG + Intergenic
920428682 1:205899814-205899836 GCTGCCAGGAAGCTTGAACTGGG + Intergenic
920589886 1:207207214-207207236 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
921043203 1:211453862-211453884 GCGGCCAGGAAGCTGGAACTGGG + Intergenic
921325668 1:213984642-213984664 GCCTCTAGAAAGCTTGCAGCAGG + Intronic
921916010 1:220611229-220611251 GCAGCCAGGAAGCTTGAACTGGG - Intronic
924059413 1:240156137-240156159 GCTACTAGGAAGGCTGAAGCGGG + Intronic
924731362 1:246714445-246714467 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1063632791 10:7749746-7749768 GCTGCTAGGGAGGTTGAAGTGGG - Intergenic
1063796694 10:9520353-9520375 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1064055661 10:12095004-12095026 GCAGATGGGAAGATTGAAGCAGG + Intronic
1064411712 10:15110900-15110922 GCTACTAGGAAGTTTGAGGCAGG - Intronic
1064572016 10:16703169-16703191 GCGTATAGGAAGCATGATGCTGG - Intronic
1064958513 10:20937933-20937955 GCGGCCAGGAAGCTTGAACTGGG + Intronic
1065049691 10:21779089-21779111 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1065080957 10:22129439-22129461 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1065230675 10:23595436-23595458 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1065293482 10:24253801-24253823 GCTGCTCGGGAGGTTGAAGCGGG + Intronic
1065473061 10:26103048-26103070 GCAGCTGGGAAGCTCGAAGTGGG - Intronic
1065606048 10:27418741-27418763 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1065738835 10:28778377-28778399 GCTACTTGGAAGCCTGAAGCAGG - Intergenic
1066060463 10:31719325-31719347 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1066709373 10:38216749-38216771 GCGGCTGGGAAGCTTGAACTGGG + Intergenic
1066785137 10:38995258-38995280 GTGGCCAGGAAGCTTGAACCAGG - Intergenic
1067149362 10:43717180-43717202 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1067850059 10:49749095-49749117 GCTGCTTGGAAGGTTGAGGCAGG + Intronic
1067904308 10:50274835-50274857 GCTACTAGGAAGGTTGAAGTGGG + Intergenic
1067955659 10:50788086-50788108 GCTGCCAGGAAGCTTGAACAGGG - Intronic
1068333491 10:55602352-55602374 GCGGCTGGGAAGCTCGAACTGGG + Intronic
1069199286 10:65592747-65592769 GCGGCCAGGAAGCTCGAACAAGG - Intergenic
1069355892 10:67584715-67584737 GTGGCTAGGAAACTTGAACTGGG - Intronic
1070197500 10:74172575-74172597 GCTGCTAGGGAGGTTGAGGCAGG + Intronic
1070217633 10:74403391-74403413 GCGGCCAGGAAGCTCGAACTAGG - Intronic
1071211126 10:83343026-83343048 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1071244399 10:83746851-83746873 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1071705608 10:87995030-87995052 GCTGCTCGGAAGGCTGAAGCAGG - Intergenic
1071999183 10:91177553-91177575 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1072374474 10:94800673-94800695 GGGGCTGGGAAGCTTGAACTGGG - Intronic
1072388769 10:94960273-94960295 GCGGCTGGGAAGCTCGAACCAGG - Intronic
1074117796 10:110470691-110470713 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1074179234 10:111043620-111043642 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1075764620 10:124883492-124883514 GCTGCTTGGAAGGCTGAAGCAGG - Intergenic
1075816580 10:125269352-125269374 GCTACTAGGAAGGCTGAAGCAGG + Intergenic
1076580899 10:131510210-131510232 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1077276625 11:1714359-1714381 GCTGCTAGGAAGGCTGAGGCAGG - Intergenic
1077523195 11:3048580-3048602 GCGGCAAAGAGGCTTGAAGTTGG - Intronic
1077718366 11:4603273-4603295 GAGGCCTGGAAGCTTGAAGTTGG - Exonic
1077950751 11:6954389-6954411 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1078190091 11:9086739-9086761 GCTACTAGGGAGGTTGAAGCAGG + Intronic
1078287987 11:9977373-9977395 GCTACTAGGAAGGCTGAAGCAGG + Intronic
1078321638 11:10340084-10340106 GTGGCTGGGAAGCTTGAACTGGG + Intronic
1078793603 11:14569702-14569724 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1078990705 11:16643561-16643583 GCGGCTGGGAAGCTTGAACTGGG - Intronic
1079037542 11:17034154-17034176 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1079125593 11:17716588-17716610 GCTGCTGGGGAGTTTGAAGCAGG + Intergenic
1079653977 11:22965565-22965587 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1079752591 11:24217589-24217611 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1079998543 11:27321602-27321624 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1080154080 11:29087929-29087951 GCTGCTAGGGAGGCTGAAGCAGG - Intergenic
1080482606 11:32667310-32667332 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1080489458 11:32747585-32747607 GCAGCAAGGAAGCTTGAACTGGG - Intronic
1080816242 11:35760140-35760162 GCGGCCAGGAAGCTTGAACTAGG - Intronic
1081308745 11:41545186-41545208 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1081697736 11:45127997-45128019 GCAGCCAGGAAGCTCGAAGTGGG - Intronic
1082117844 11:48346458-48346480 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1082145209 11:48658390-48658412 GTGGCTGGGAAGCTTGAAAAGGG - Intergenic
1082172658 11:49024886-49024908 GTGCCTTGGAAGGTTGAAGCAGG + Intergenic
1082568912 11:54714207-54714229 GCGGCCTGGAAGCTTGAACTAGG - Intergenic
1083310556 11:61781531-61781553 CAGGCTAAGAAGCTGGAAGCTGG - Intronic
1083438173 11:62657537-62657559 GCTACTTGGAAGGTTGAAGCAGG + Intronic
1083494772 11:63041933-63041955 GCGACCAGGAAGCTTGAAATGGG - Intergenic
1085247999 11:75119771-75119793 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1085528266 11:77176487-77176509 GCAGCTAGGAAGCAGGGAGCAGG + Intronic
1085967028 11:81539934-81539956 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1086567263 11:88240974-88240996 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1087004720 11:93458519-93458541 GTGGCTAGGAAGCTCGAACTGGG + Intergenic
1087072912 11:94099660-94099682 GCGGCTGGGAAGCTCGAACTGGG - Intronic
1087088993 11:94248529-94248551 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1087103196 11:94384693-94384715 GCGGCCAGGAAGCTTGAATTGGG + Intronic
1088491044 11:110388410-110388432 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1088629700 11:111762863-111762885 GAGGCTTGGAAGCATGAAACAGG - Intronic
1089192872 11:116667181-116667203 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1089676994 11:120096868-120096890 GCGGCTGGGGAATTTGAAGCGGG - Intergenic
1089888504 11:121855378-121855400 GCGGCTAGGAAGCTCGAACTGGG + Intergenic
1090322310 11:125857831-125857853 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1090932738 11:131313017-131313039 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
1091706877 12:2699982-2700004 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1091867276 12:3851598-3851620 GTGGCCAGGAAGCTTGAACTGGG + Intronic
1092461536 12:8691235-8691257 GCTGCTTGGAAGATTGAGGCAGG - Intronic
1092714778 12:11377647-11377669 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1093217687 12:16382787-16382809 GCGGCTGGGAAGCTGGAACTGGG - Intronic
1093314219 12:17628174-17628196 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1093609569 12:21137479-21137501 GCGGCTGGGAAGCTCGAACTGGG - Intronic
1093615230 12:21214589-21214611 GCGGCCTGGAAGCTCGAAGTGGG - Intronic
1093802333 12:23389160-23389182 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1093824260 12:23663211-23663233 GCTGCTGGCAAGCTTGAAACTGG - Intronic
1094561236 12:31555698-31555720 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1094735359 12:33228042-33228064 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1094779396 12:33773345-33773367 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1094803462 12:34065460-34065482 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
1094839401 12:34336646-34336668 GCGGCAGGGAAGCTTGAAAGGGG + Intergenic
1094844330 12:34354863-34354885 GCGGCAGGGAAGCTTGAAAGGGG - Intergenic
1095054423 12:37582545-37582567 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
1095073845 12:37892882-37892904 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1095089652 12:38091811-38091833 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1095261960 12:40107174-40107196 GCTGCTAGGAAGGCTGAGGCAGG - Intergenic
1095483412 12:42659015-42659037 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1095591314 12:43906960-43906982 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1095625428 12:44308729-44308751 GCTACTGGGAAGCCTGAAGCAGG - Intronic
1095911142 12:47427381-47427403 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1095925643 12:47576403-47576425 GCAGGTAGGAAGCTGGAAGGAGG - Intergenic
1095992033 12:48041798-48041820 GTGGCTAGGAGGCTTTGAGCTGG - Intergenic
1096817993 12:54213765-54213787 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
1096962927 12:55598558-55598580 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1097149559 12:56966470-56966492 GCAGCTGGGAAGCTTGAAATGGG + Intergenic
1097301354 12:58022786-58022808 GTGGCAAGGAAGCTTGAACTGGG - Intergenic
1097734591 12:63167902-63167924 GCAGCCAGGAAGCTCGAAGAGGG - Intergenic
1098722834 12:73924622-73924644 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1099314295 12:81065169-81065191 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1099779147 12:87171880-87171902 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1099925924 12:89017069-89017091 GCTGCTAGGGAGCCTGAGGCAGG - Intergenic
1100563847 12:95775675-95775697 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1100648065 12:96552132-96552154 GCTGCTTGGAAGCCTGAGGCAGG + Intronic
1100748661 12:97673039-97673061 GTGGCTAGGAAGCTTGAACCTGG + Intergenic
1100907773 12:99321352-99321374 GTGGCTGGGAAGCTTGAACTGGG - Intronic
1101556935 12:105818896-105818918 GAGGCTAAGAAGCTTGGAACAGG + Intergenic
1101622072 12:106398326-106398348 GCGGCTGGGAAGCTCGAACTGGG + Intronic
1101748734 12:107565102-107565124 GAGGCTGGGAAGCTGGAAACAGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103011285 12:117460421-117460443 GGGGATAGGAAGCCTGGAGCAGG + Exonic
1103087036 12:118069535-118069557 GCTGCTTGGGAGGTTGAAGCAGG - Intronic
1104206322 12:126642374-126642396 GAGGCTAGGAAGCTCGAACTGGG - Intergenic
1104457648 12:128928730-128928752 GCTGCTAGGAAGACTGAGGCTGG - Intronic
1105902458 13:24767634-24767656 GCTGCTCGGTAGCCTGAAGCAGG + Intronic
1107380684 13:39853924-39853946 GTGGCCAGGAAGCTTGAACAGGG - Intergenic
1107673037 13:42766500-42766522 GCTACTAGGAAGGCTGAAGCAGG - Intergenic
1107971336 13:45645508-45645530 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1108188101 13:47908444-47908466 GAGGCCAGGAAGCTTGAACTGGG + Intergenic
1108230897 13:48339320-48339342 GCGGCCAGGAAGCTTGAACTGGG - Intronic
1108334844 13:49429205-49429227 GCTACTAGGAAGGTTGAAGCAGG - Intronic
1109113456 13:58352204-58352226 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1109447799 13:62466886-62466908 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1109633492 13:65083991-65084013 GCTACTAAGAAGGTTGAAGCAGG - Intergenic
1109659153 13:65435868-65435890 GCAGCTAGGAATCTTGAACTGGG + Intergenic
1109675890 13:65675479-65675501 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1110729740 13:78866347-78866369 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1111734093 13:92115392-92115414 GCTACTGGGAAGGTTGAAGCAGG + Intronic
1111967040 13:94871258-94871280 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1112075358 13:95907247-95907269 GCGGCTGGGAAGCTCGAACTAGG + Intronic
1112663808 13:101544701-101544723 GCGGCCAGGAAGCTTGAACTGGG - Intronic
1114240283 14:20860592-20860614 GCCGCTTGGAAGCTTGAACTGGG + Intergenic
1114432874 14:22677687-22677709 GCAGCTGGGAAGCTTGAACTAGG - Intergenic
1115123121 14:29961018-29961040 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1115277051 14:31621046-31621068 GCCGCCAGGAAGTTTGAAGTGGG - Intronic
1115743498 14:36412192-36412214 GCGGCCAGGAAGCTCGAACTCGG + Intergenic
1115774370 14:36699603-36699625 GCGGCCAGGAAGCTTGAACTGGG - Intronic
1115818464 14:37188243-37188265 GCGGCAGGGAAGCTTGAACTGGG + Intergenic
1115833067 14:37363788-37363810 GCGGCCAGGAAACTTGAACTGGG - Intronic
1116198315 14:41757404-41757426 GCGGCCAGGAAGATTGAACTGGG - Intronic
1116851541 14:49914079-49914101 GCTGCTAGGGAGGTTGAGGCAGG - Intergenic
1116907777 14:50422001-50422023 GCTACTCGGAAGGTTGAAGCAGG - Intronic
1117104559 14:52384656-52384678 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1117349905 14:54870842-54870864 GCGGCTGGGAAGCTTGAACTGGG + Intronic
1117892670 14:60443511-60443533 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1118559861 14:67067608-67067630 GTGGCCAGGAAGCTTGAACTGGG - Intronic
1118938490 14:70310723-70310745 GCGGCCGGGAAGCTTGAACTGGG - Intergenic
1119018466 14:71084610-71084632 GCTGCCAGGAAGTTTGAACCAGG - Intronic
1119100770 14:71878328-71878350 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1120478899 14:85024001-85024023 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
1120559629 14:85974713-85974735 GCAGCTAGGAAGCTCGAACTGGG - Intergenic
1120856062 14:89213425-89213447 GCTGCTAGGAAACTCGAAGATGG + Intronic
1120959273 14:90109818-90109840 GCTGCTCGGAAGGTTGAAGTGGG - Intronic
1121270520 14:92634744-92634766 GCTGCTTGGGAGGTTGAAGCAGG + Intronic
1123397188 15:19948697-19948719 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1123949412 15:25256071-25256093 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1124464161 15:29921186-29921208 AGGGCCAGGAAGCTTGAGGCTGG - Intronic
1124569983 15:30854253-30854275 GCGGCCAGAAAGCTTGAACTGGG - Intergenic
1125352150 15:38779244-38779266 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1126542489 15:49838866-49838888 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1126719850 15:51567152-51567174 GCTGCTAGGAAGGCTGAGGCAGG - Intronic
1126768525 15:52032794-52032816 GCTGCTAGGGAGGTTGAGGCAGG - Intronic
1126888993 15:53183718-53183740 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1127193743 15:56561877-56561899 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1127715987 15:61649941-61649963 GCTACTTGGAAGCTTGAGGCTGG + Intergenic
1127793679 15:62420506-62420528 GCTGCTCGGAAGGCTGAAGCAGG - Intronic
1128416754 15:67453871-67453893 GCGGCCGGGAAGCTTGAACTGGG - Intronic
1129548801 15:76426260-76426282 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1129581750 15:76819080-76819102 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1130038469 15:80383001-80383023 GAGGCTAGGAAGGGTGGAGCAGG + Intronic
1130800242 15:87255388-87255410 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1130802612 15:87280964-87280986 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1131589256 15:93730863-93730885 GCGGCTGAGAAGCTTGAACTGGG - Intergenic
1131985407 15:98038688-98038710 GCTCCTGGGAAGCCTGAAGCAGG - Intergenic
1132455660 16:20804-20826 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1132828550 16:1916783-1916805 GGGGCTACCAAGCTAGAAGCTGG - Intronic
1134408332 16:13982125-13982147 GCTACTTGGAAGCCTGAAGCAGG + Intergenic
1134767603 16:16774505-16774527 GCTGCTGGGAAGCTTGAACTGGG - Intergenic
1134829710 16:17313249-17313271 GAGGCCAGGAAGCAGGAAGCTGG + Intronic
1135197063 16:20403399-20403421 GCTGCTAGGGAGGTTGAAGCAGG - Intronic
1135204300 16:20469823-20469845 GGGACTAGGAAGAGTGAAGCTGG + Intronic
1135214696 16:20555143-20555165 GGGACTAGGAAGAGTGAAGCTGG - Intronic
1135301749 16:21334688-21334710 GCGGCTGGGAAGTTTGAACTGGG - Intergenic
1135509236 16:23068258-23068280 GCTGCTGGGAAGCTGGAGGCTGG + Exonic
1135897344 16:26419704-26419726 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1136561984 16:31044658-31044680 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
1137808551 16:51330289-51330311 GCGGCTAGGAAGCTCGAACTGGG + Intergenic
1137877707 16:52013260-52013282 GCGGCTGGGAAGCTCGAACTGGG - Intronic
1137907080 16:52333886-52333908 GCGGCTAGGAAGCTAGAACTGGG + Intergenic
1138075972 16:54042571-54042593 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1138720377 16:59072736-59072758 GCGGCCGGGAAGCTCGAACCCGG + Intergenic
1138874781 16:60936417-60936439 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1139831572 16:69802710-69802732 GCTACTTGGAAGCTTGAGGCAGG - Intronic
1140456502 16:75108892-75108914 GAGGTTAGGAAGCTTGTAGGAGG - Exonic
1140695168 16:77525433-77525455 GCGGCCGGGAAGCTTGAACTGGG + Intergenic
1140758251 16:78088434-78088456 GTGGCTCAGAAGCCTGAAGCTGG + Intergenic
1141235143 16:82209408-82209430 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1141983034 16:87561614-87561636 GCCTCTAGGAAGCTGGGAGCGGG + Intergenic
1142220453 16:88851847-88851869 GCGGCAGGGAAGCTCGAACCGGG + Intronic
1142951366 17:3483772-3483794 GCTACTAGGGAGCTTGAGGCAGG - Intronic
1142973990 17:3632335-3632357 GCCACTGGGAAGGTTGAAGCAGG + Intronic
1143257599 17:5573310-5573332 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1143708005 17:8713754-8713776 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1144815339 17:18030393-18030415 GCTACTAGGAAGGCTGAAGCAGG + Intronic
1145731284 17:27188581-27188603 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1146298517 17:31670569-31670591 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1146732317 17:35204457-35204479 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1149133767 17:53340350-53340372 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1149192984 17:54086115-54086137 GAGGCCTGGAAGCATGAAGCGGG + Intergenic
1149721747 17:58851927-58851949 GTGGCTGGGAAGCTTGAACTGGG - Intronic
1149886187 17:60342581-60342603 GCTGCCAGGAAGCTTGAACTGGG - Intronic
1150253629 17:63725461-63725483 GCTGCTAGGGAGACTGAAGCAGG - Intronic
1150777324 17:68091992-68092014 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1150970500 17:70021731-70021753 GTGGCCTGTAAGCTTGAAGCTGG + Intergenic
1152760489 17:82104833-82104855 CCGGCTTGGAGGTTTGAAGCTGG + Intronic
1153441296 18:5122470-5122492 GCAGCTAGGAAGCATGAACTGGG + Intergenic
1153865546 18:9265119-9265141 GTGGCCAGGAAGCTCGAAGTGGG + Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1155568481 18:27163461-27163483 GCGGCCAGGAAGCTTGAACTGGG - Intronic
1155597980 18:27510487-27510509 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1156186649 18:34671069-34671091 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1156229216 18:35137790-35137812 GAGGATAGGAAGCTTGGAGAGGG + Intronic
1156308131 18:35897959-35897981 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1156762768 18:40613326-40613348 AGGGCTAGGAAAATTGAAGCTGG + Intergenic
1157419345 18:47532003-47532025 GCTGCTTGGAAGCTCGCAGCGGG + Intergenic
1157920117 18:51706245-51706267 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1160285385 18:77537798-77537820 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1160289523 18:77578215-77578237 GCGGCTGGGAAGCTTGAACTGGG + Intergenic
1161132843 19:2601793-2601815 GCTACTAGGGAGGTTGAAGCGGG + Intronic
1161856476 19:6768429-6768451 GCTGCTTGGAAGGCTGAAGCGGG - Intergenic
1161914100 19:7216020-7216042 GTGGCTAAGAAGATGGAAGCAGG + Intronic
1162297023 19:9820277-9820299 GCGGCCAGGAAACTTGAACTTGG - Intronic
1162717549 19:12643434-12643456 GCGGCCAGGAAACTTGAACTTGG + Intergenic
1162755470 19:12856412-12856434 GCTGCTTGGAAGGCTGAAGCAGG - Intronic
1163713726 19:18862165-18862187 GCGGCTGGGCAGCATGCAGCAGG - Intronic
1163858546 19:19726733-19726755 GCGGCTGGGAAGCTCGAACTGGG - Intronic
1164367578 19:27602609-27602631 GTGGCTAGGAAGCTTGAACTGGG - Intergenic
1164377459 19:27701087-27701109 GTGGCTAGGAAGCTCGAACTTGG - Intergenic
1164495533 19:28757325-28757347 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1165659288 19:37561127-37561149 GCTACTTGGAAGGTTGAAGCAGG + Intronic
1166116338 19:40657444-40657466 GCTACTTGGAAGGTTGAAGCAGG - Intergenic
1167897725 19:52594623-52594645 GCTGCTAGGCAGGTTGAAGCAGG - Intronic
1168022772 19:53621671-53621693 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1168420583 19:56200068-56200090 GCTGCTAGGGAGGCTGAAGCAGG - Intergenic
1168424780 19:56230546-56230568 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
925117021 2:1388357-1388379 GCGGCCAGGAAGCTCGAACTGGG - Intronic
925225044 2:2176608-2176630 GCTACTAGGGAGGTTGAAGCAGG - Intronic
925987906 2:9230969-9230991 GCTGCCAGGAAGCAAGAAGCTGG - Intronic
926051994 2:9751271-9751293 GCAGGTAGGAAGCCTGCAGCTGG + Intergenic
926601314 2:14848541-14848563 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
926649641 2:15328825-15328847 GCGGATAGGATGCATAAAGCAGG - Intronic
927576324 2:24204689-24204711 GCGCCGAGGAAGCATGCAGCAGG - Intronic
928522706 2:32106108-32106130 GCAGCTAGGAAGCTTGAACTGGG - Intronic
929233168 2:39580661-39580683 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
929819274 2:45260362-45260384 TTGGGTGGGAAGCTTGAAGCTGG - Intergenic
931043646 2:58325820-58325842 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
931305185 2:61021508-61021530 GCGCCCAGGAAGCTTGAACTGGG + Intronic
931698750 2:64891498-64891520 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
932019092 2:68064237-68064259 GTGGCCAGGAAGCTTGAACTGGG + Intronic
932736932 2:74260797-74260819 ACCCCTGGGAAGCTTGAAGCAGG - Intronic
932935395 2:76096304-76096326 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
933257589 2:80098653-80098675 GCGGCTAGGAAGCTCGAACTGGG - Intronic
933593895 2:84262849-84262871 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
934531617 2:95093195-95093217 GCGGCCAGGAAGCTCGAACTGGG + Intronic
934552415 2:95270542-95270564 GCCGCTAGGAGGTTTGAAGCAGG + Intergenic
934617093 2:95778941-95778963 GCTGCCAGGAAGCTTGAACTGGG + Intergenic
934643800 2:96045618-96045640 GCTGCCAGGAAGCTTGAACTGGG - Intergenic
934741064 2:96722906-96722928 GCTGCTTGGAAGTCTGAAGCAGG + Intronic
934837216 2:97601712-97601734 GCTGCCAGGAAGCTTGAACTGGG - Intergenic
935118256 2:100157307-100157329 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
935821114 2:106893873-106893895 GCTACTAGGGAGGTTGAAGCGGG - Intergenic
936355326 2:111745348-111745370 GCTGCTAGGGAGGGTGAAGCAGG - Intergenic
936823551 2:116553262-116553284 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
937186762 2:120051302-120051324 GCTGCTAGGAAGCTTGAACTGGG - Intronic
937507252 2:122551185-122551207 GCGGCTGGGAAGCTAGAACTGGG + Intergenic
939031088 2:137076234-137076256 GCGGCCAGGAAGCTCGAACTGGG - Intronic
940055277 2:149506906-149506928 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
940095177 2:149966213-149966235 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
940124165 2:150305133-150305155 GCGGCTTGGAAGGCTGAAGCAGG - Intergenic
941776553 2:169399660-169399682 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
941912893 2:170782984-170783006 GCTACTAGGAAGGCTGAAGCAGG + Intergenic
942000988 2:171646919-171646941 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
942560023 2:177210322-177210344 GCTGCTGGGAAGGCTGAAGCAGG - Intergenic
942790707 2:179757609-179757631 GTGGCCAGGAAGCTTGAACTGGG - Intronic
942854771 2:180532243-180532265 GCGGCCAGGAAGCTTGCACTGGG - Intergenic
943066266 2:183089883-183089905 GCTACTAGGAAGGCTGAAGCAGG - Intronic
943255749 2:185591409-185591431 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
943359614 2:186901769-186901791 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
943549338 2:189319659-189319681 GCGACCAGGAAGCTTGAACTGGG + Intergenic
943583532 2:189712083-189712105 GCGGCCGGGAAGCTTGAACTGGG + Intronic
943652433 2:190471587-190471609 GCGGCTGGGAAGCTTGAACTGGG + Intronic
944077082 2:195744352-195744374 GCAGCCAGGAAGCTTGAACTGGG + Intronic
944520984 2:200566717-200566739 GCGGCTAGGAAGCTTGAAGCCGG - Intronic
945614960 2:212055291-212055313 GCGGCCAGGAAGCTCGAACTGGG + Intronic
945837183 2:214847264-214847286 GTGGCCAGGAAGCTTGAACTTGG - Intergenic
946242531 2:218365670-218365692 GCTACTAGGAAGGCTGAAGCAGG - Intronic
946294452 2:218772906-218772928 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
946455087 2:219819152-219819174 GCGGCCGGGAAGCTTGAACTGGG - Intergenic
947194355 2:227546140-227546162 GTGGCCAGGAAGCTTGAACTAGG - Intronic
1169012848 20:2264905-2264927 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1169402763 20:5297074-5297096 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1169697225 20:8403646-8403668 GCTACTTGGAAGCCTGAAGCAGG + Intronic
1171050509 20:21853902-21853924 GCGGCCAGGAAGTTTGAACTGGG + Intergenic
1171065410 20:22009906-22009928 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1171068785 20:22046114-22046136 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1171094394 20:22317396-22317418 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1171194285 20:23185565-23185587 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1171819113 20:29817205-29817227 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1172088472 20:32408662-32408684 GCGCCTTGGGAGCTTGAGGCAGG - Intronic
1172548670 20:35781831-35781853 GCCACTAGGGAGCCTGAAGCAGG + Intronic
1173291383 20:41717996-41718018 ATGGCAAGGAAGATTGAAGCTGG - Intergenic
1175492538 20:59388904-59388926 GCTACTAGGAAGGCTGAAGCAGG + Intergenic
1176554131 21:8245941-8245963 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
1176573053 21:8428965-8428987 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
1176878858 21:14167201-14167223 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1178044419 21:28677391-28677413 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1178888469 21:36500541-36500563 GCTACTAGGGAGGTTGAAGCAGG - Intronic
1182029413 22:27145920-27145942 GCTGCTCGGGAGCCTGAAGCAGG + Intergenic
1182162173 22:28133704-28133726 GTGGCTGGGAAGCTTGAACTGGG + Intronic
1203259137 22_KI270733v1_random:162989-163011 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
949209220 3:1477961-1477983 GCGGCTGGGAAGCTTGAACTGGG + Intergenic
949428119 3:3941539-3941561 GCGGCCAGGAAGCTTGAACTGGG - Intronic
949549945 3:5104398-5104420 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
949632551 3:5944228-5944250 GCAGCCAAGAAGCTCGAAGCGGG - Intergenic
950073022 3:10167524-10167546 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
950147062 3:10657591-10657613 GCGGCCTGGAAGCTTGAACTGGG + Intronic
950299864 3:11867656-11867678 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
950873317 3:16247996-16248018 GCGGCTAGGAGGCTGGTAGGTGG - Intergenic
951042686 3:18005335-18005357 GCGGCTGGGAAGCTCGAACTGGG - Intronic
951120982 3:18928444-18928466 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
951286598 3:20821040-20821062 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
951330760 3:21365333-21365355 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
951469081 3:23036086-23036108 GAGGCCAGGAAGCTTGAACTGGG - Intergenic
951482565 3:23177240-23177262 GCGACTAGGAAGGCTGAGGCAGG + Intergenic
951672922 3:25205072-25205094 GCAGCCAGGAAGCTCGAACCGGG - Intronic
951684499 3:25329017-25329039 GCAGCCAGGAAGCTTGAACAGGG + Intronic
951751588 3:26042268-26042290 GCAGCTGGGAAGCTTGAACGGGG - Intergenic
951914973 3:27790892-27790914 GCTGCTAGGGAGGCTGAAGCAGG + Intergenic
952104171 3:30050382-30050404 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
952550544 3:34471888-34471910 GCGGCCAGGAAGCTCGAAATGGG - Intergenic
952586947 3:34904609-34904631 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
952680229 3:36083213-36083235 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
953653099 3:44823667-44823689 GCGGCCTGGAAGCTTGAACTGGG - Intronic
954058140 3:48045144-48045166 GCTGCTAGGGAGCCTGAGGCAGG + Intronic
954492690 3:50922203-50922225 GTGGCCAGGAAGCTTGAACTGGG - Intronic
954537056 3:51368548-51368570 GCGGCTGGGAAGCTCGAACTGGG + Intronic
955143361 3:56291617-56291639 GGGGCTAGGCAGTGTGAAGCTGG - Intronic
955240701 3:57175531-57175553 GCTGCTTGGGAGGTTGAAGCAGG - Intergenic
955504152 3:59614325-59614347 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
956437072 3:69244519-69244541 GCTGCTTGGGAGGTTGAAGCAGG + Intronic
956926167 3:73991189-73991211 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
957061892 3:75489111-75489133 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
957130213 3:76214656-76214678 GCAGCCAGGAAGCTTGAACTGGG + Intronic
957554403 3:81748006-81748028 GCTACTAGGGAGGTTGAAGCAGG + Intronic
958185146 3:90110638-90110660 GCAGCCAGGAAGCTTGAAATGGG - Intergenic
958810932 3:98859219-98859241 GCGGCCAGGAAGCTCGAACTGGG + Intronic
959103500 3:102040403-102040425 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
959464221 3:106665772-106665794 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
959724552 3:109528866-109528888 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
959823831 3:110769309-110769331 GCGGCTTGGAAGCTCGAACTGGG + Intergenic
960175759 3:114515923-114515945 GAGCTTAGGAAGCTTGAAGGTGG - Intronic
960478825 3:118163094-118163116 GTGGCCAGGAAGCTCGAAGTGGG + Intergenic
960832351 3:121863342-121863364 GCAGCCTGGAAGCTTGAACCAGG - Intronic
960860029 3:122142741-122142763 GTGGCCAGGAAGCTTGAACTAGG - Intergenic
961396080 3:126591632-126591654 GAGGCCAGGAAGCTTGAAATGGG - Intronic
961956050 3:130805114-130805136 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
962643519 3:137412957-137412979 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
962675198 3:137751160-137751182 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
962761397 3:138518176-138518198 GCGGCCAGGAAGCTCGAACTGGG + Intronic
963029489 3:140953856-140953878 GCTGCTAGGGAGGCTGAAGCAGG + Intronic
963281750 3:143390944-143390966 GCGGCTGGGAAGCTTGAACTAGG + Intronic
963620465 3:147599489-147599511 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
964155922 3:153584464-153584486 GCGGCGGGGAAGCTTGAACTGGG + Intergenic
964175644 3:153823825-153823847 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
964214378 3:154263059-154263081 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
964243205 3:154619848-154619870 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
964748987 3:160037714-160037736 GCTACTAGGAAGGTTGAGGCAGG - Intergenic
965311094 3:167129832-167129854 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
965717737 3:171625342-171625364 GCAGCCAGGAAGCTTGAACTGGG + Intronic
966115284 3:176453817-176453839 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
966136594 3:176706014-176706036 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
966537012 3:181046424-181046446 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
966913906 3:184574606-184574628 GGGGCTTGGCAGCATGAAGCTGG + Intronic
967248508 3:187513176-187513198 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
967339235 3:188378354-188378376 GCGGCCAGGAAGCTTGAACTCGG - Intronic
968155981 3:196380969-196380991 GCGGCTGGGAAGCTTGAACTGGG + Intronic
969059343 4:4422677-4422699 GCCGCTGGGAGGTTTGAAGCAGG + Intronic
969100333 4:4763665-4763687 GCGGCTAGGAAGGAGGCAGCAGG - Intergenic
969962798 4:10962675-10962697 GCAGCCAGGTAGCATGAAGCAGG + Intergenic
970387434 4:15569934-15569956 ACGGCTAGGAAACATGAGGCTGG - Intronic
970975716 4:22040842-22040864 GCGGCCAGGAAGTTTGAACTGGG - Intergenic
971247068 4:24938888-24938910 GCGGCCGGGAAGCTTGAACTGGG + Intronic
971649870 4:29257757-29257779 GCTACTAGGAAGGTTGAAGTGGG - Intergenic
972312259 4:37891838-37891860 GCGGCTAGAAACAATGAAGCAGG - Intronic
972806417 4:42533225-42533247 TCAGCTGGGAAGCTTGTAGCTGG + Intronic
972946659 4:44264879-44264901 GCAGCTGGGAAGCTTGAACTGGG + Intronic
972995989 4:44879938-44879960 GCAGCCGGGAAGCTTGAACCGGG + Intergenic
973679179 4:53298439-53298461 GCGGCCAGGAAGCTCGAACTGGG + Intronic
973732265 4:53833812-53833834 GCAGCCAGGAAGCTTGAACTGGG + Intronic
973776207 4:54244054-54244076 GCGGCTGGGAAGCTCGAACAGGG + Intronic
974023693 4:56713118-56713140 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
974115231 4:57571075-57571097 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
974287823 4:59892442-59892464 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
974654343 4:64799958-64799980 GAGGCCAGGAAGCTTGAACTGGG + Intergenic
974780373 4:66545556-66545578 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
974917317 4:68194538-68194560 GCGGCTGGGAAGCTTGAACTGGG + Intergenic
974944050 4:68505029-68505051 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
975002686 4:69244829-69244851 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
975010792 4:69348816-69348838 GTGGCCAGGAAGCTTGAACTGGG - Intronic
975287442 4:72636990-72637012 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
975295596 4:72730857-72730879 GCTGCCAGGAAGCTTGAACTGGG + Intergenic
975726896 4:77301140-77301162 GTGGCCAGGAAGCTTGAACTGGG - Intronic
975753573 4:77549996-77550018 GCAGCTAGGAAGCTTGAACTGGG - Intronic
975844002 4:78506405-78506427 GCGGCTGGGAAGCTCGAACTGGG - Intronic
976158741 4:82175881-82175903 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
976170876 4:82303194-82303216 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
976585392 4:86791339-86791361 GCGGCCGGGAAGCTTGAACAGGG + Intronic
976760098 4:88539409-88539431 GCAGCCAGGAAGCTTGAACTGGG + Intronic
976918520 4:90408128-90408150 GCGGCTGGGAAGCTCGAACTAGG + Intronic
976998234 4:91462852-91462874 GTGGCCAGGAAGCTTGAACTGGG + Intronic
977108658 4:92921994-92922016 GTGGCCAGGAAGCTTGAACTGGG - Intronic
977203840 4:94148180-94148202 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
977219777 4:94325437-94325459 GCGGCTGGGAAGCTTGAACTGGG - Intronic
977946493 4:102919895-102919917 GCGGCTGGGAAGCTTGAACTGGG + Intronic
978012766 4:103707995-103708017 GCGGCCAGGAAGCTTGAACTGGG + Intronic
978108286 4:104930936-104930958 GCGGCCAGGAAGTTTGAACTGGG + Intergenic
978176239 4:105735322-105735344 GCGGCCTGGAAGCTTGAACTGGG - Intronic
978188006 4:105880640-105880662 GCTGCCAGGAAGCTTGAACTGGG + Intronic
978209662 4:106120430-106120452 GCAGCTGGGAAGCTTGAACTGGG + Intronic
978601399 4:110431929-110431951 GCCACTAGGAAGCTTGAACTGGG - Intronic
978632502 4:110763134-110763156 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
978694875 4:111565618-111565640 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
979042144 4:115812153-115812175 GCGGCCAGGAAGCTCGAATTGGG + Intergenic
979462673 4:121001666-121001688 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
979730134 4:124014061-124014083 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
980217968 4:129876387-129876409 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
980231513 4:130051844-130051866 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
980848776 4:138355232-138355254 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
981096574 4:140788357-140788379 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
981345674 4:143673739-143673761 GCGGCCAGGAAGCTTGAACTGGG - Intronic
981445834 4:144837187-144837209 GCGGCTGGGAAACTTGAATTGGG + Intergenic
981655942 4:147112418-147112440 GCAGCCAGGAAGCTTGAACAGGG + Intergenic
982406046 4:155021420-155021442 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
982691245 4:158550099-158550121 GCAGCTGGGAAGCTTGAACTGGG - Intronic
983385447 4:167055790-167055812 GCAGCCAGGAAGCTTGAACTGGG + Intronic
983427285 4:167601760-167601782 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
983668319 4:170207565-170207587 GCGGCAAGGAAGCTTGAACCGGG + Intergenic
983673841 4:170268953-170268975 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
983829052 4:172302016-172302038 GCGGCTGGGAATCTTGAACTGGG - Intronic
984024025 4:174522036-174522058 GTGGATTGGAATCTTGAAGCAGG - Exonic
984063467 4:175020217-175020239 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
984394973 4:179185777-179185799 GCTGCTTGGAAGGTTGAGGCAGG + Intergenic
985663777 5:1171094-1171116 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
985766607 5:1783210-1783232 GCTGCTAGGAAGGGTGAGGCTGG + Intergenic
985794791 5:1953898-1953920 GCGGCTAGGAAGCTCGAACTGGG + Intergenic
987307212 5:16648833-16648855 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
987678639 5:21107889-21107911 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
989087291 5:37689174-37689196 GCAGCTAGGAAGCTTGAACTGGG + Intronic
989522452 5:42418077-42418099 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
989528748 5:42482529-42482551 GCGGCCAGGAAGCTCGAACTGGG - Intronic
989568922 5:42927094-42927116 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
989660479 5:43792117-43792139 GCGGCTGGGAAGCTCGAACTAGG + Intergenic
989779115 5:45243482-45243504 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
990437590 5:55808963-55808985 GCGGCCAGGAAGCTCGAACTGGG - Intronic
990541942 5:56781971-56781993 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
990860367 5:60320129-60320151 GCGGCTGGGAAGCTCGAACTGGG - Intronic
991052945 5:62292017-62292039 GTGGCCAGGAAGCTCGAACCGGG + Intergenic
991099808 5:62780202-62780224 GCTGCTTGGGAGGTTGAAGCAGG + Intergenic
991421775 5:66449928-66449950 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
991538836 5:67704153-67704175 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
992280951 5:75176227-75176249 GCGGCCAGGAAGCTCGAACTGGG + Intronic
992338483 5:75798275-75798297 GCCGCCAGGAAGCTTGAACTAGG - Intergenic
992580915 5:78174875-78174897 GCGGCTGGGAAGCTTGAATTGGG - Intronic
992811851 5:80396765-80396787 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
993142380 5:84050807-84050829 GCAGCCAGGAAGCTTGAACTGGG + Intronic
993341622 5:86731463-86731485 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
993370332 5:87084901-87084923 GCGTCCAGGAAGCTTGAACTGGG + Intergenic
993493492 5:88580991-88581013 GCTACTAGGGAGCCTGAAGCAGG + Intergenic
993947995 5:94138102-94138124 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
994233519 5:97336153-97336175 GCTGCTAGGAAGTTTGAACTGGG - Intergenic
994287856 5:97991793-97991815 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
994350287 5:98737674-98737696 GCAGCTGGGAAGCTCGAACCGGG + Intergenic
994545658 5:101163317-101163339 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
994565636 5:101442531-101442553 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
994780232 5:104079885-104079907 GCAGCCAGGAAGCTCGAAGTGGG - Intergenic
994806310 5:104451907-104451929 GCAGCCAGGAAGCTCGAAGTGGG - Intergenic
995270721 5:110217156-110217178 GCGGCCAGGAGGCTTGAACTGGG - Intergenic
995570181 5:113471804-113471826 GCGGCTGGGAAGCTCGAACTGGG - Intronic
995692668 5:114844896-114844918 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
996013054 5:118502415-118502437 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
996231077 5:121064716-121064738 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
996247313 5:121280554-121280576 GCTGCTAGGGAGGCTGAAGCGGG + Intergenic
996788617 5:127268582-127268604 GGGGCCAGGAAGCTTGAACTGGG + Intergenic
997137765 5:131344493-131344515 GCGGCCAGGAAGCTCGAACTGGG + Intronic
997184867 5:131871491-131871513 GCGGCTGGGAAGCTCGAACTGGG + Intronic
997271013 5:132538013-132538035 GCTGCTAGGGAGGCTGAAGCAGG + Intergenic
997797831 5:136828659-136828681 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
997808837 5:136947077-136947099 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
998241730 5:140452214-140452236 GCGGCTAGGAAGCTCAAACTGGG + Intronic
998541942 5:142991110-142991132 GCGGCCAGGAAGCTCGAACTGGG - Intronic
998803189 5:145891627-145891649 GCGGCCAGGAAGCTCGAACTCGG + Intergenic
998857953 5:146412731-146412753 GCTACTCGGAAGCCTGAAGCAGG - Intergenic
999064754 5:148673843-148673865 GCAGCCAGGAAGCTTGAACTGGG - Intronic
999947238 5:156610689-156610711 GTGGCCAGGAAGCTTGAACTGGG - Intronic
1000553613 5:162696413-162696435 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1001074679 5:168616815-168616837 GCGGCCAGGAAACTTGAACTTGG - Intergenic
1001389362 5:171366435-171366457 GCGGCCAGGAAACTTGAACTTGG - Intergenic
1001391028 5:171379472-171379494 GCTACTCGGAAGGTTGAAGCAGG - Intergenic
1002290569 5:178197866-178197888 GCTGCTAGGGAGGTTGAAGCGGG + Intergenic
1003165855 6:3677831-3677853 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1003388516 6:5691835-5691857 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1003448910 6:6212143-6212165 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1003647522 6:7926169-7926191 GTGGCTGGGAAGCTTGAACTGGG + Intronic
1003649772 6:7948822-7948844 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1004260228 6:14101504-14101526 TGGGAAAGGAAGCTTGAAGCAGG - Intergenic
1004565687 6:16794687-16794709 GCTACTTGGAAGGTTGAAGCAGG + Intergenic
1005177038 6:23058840-23058862 GCGGCTAGGAAGCTCGAACTGGG + Intergenic
1005193880 6:23259927-23259949 GCGGCTGGGAAGCTTGAATTGGG - Intergenic
1005202676 6:23364618-23364640 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1005373511 6:25158667-25158689 GCGGCCAGGAAGCTCGAACTAGG + Intergenic
1005788710 6:29273925-29273947 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1006432784 6:34008054-34008076 GCCGCTGGGAGGCTTTAAGCAGG - Intergenic
1007211916 6:40199471-40199493 GCTGCTAGGAAGGCTGAGGCAGG - Intergenic
1007860222 6:44900516-44900538 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1008253945 6:49275001-49275023 GCGGCCAGGAAGCTTGAGCTGGG + Intergenic
1008412220 6:51193317-51193339 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1009282445 6:61769679-61769701 GCGGCCAGGAAGCTGGAACTGGG + Intronic
1009322771 6:62312511-62312533 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1009457932 6:63878624-63878646 GCAGCCAGGAAGCTCGAAGTGGG - Intronic
1009695323 6:67095889-67095911 GCGGCCAGGAAGCTGGAACTGGG + Intergenic
1009943627 6:70318048-70318070 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1010553522 6:77252000-77252022 GCAGCCAGGAAGCTTGAAATGGG + Intergenic
1010679622 6:78783607-78783629 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1010721253 6:79285152-79285174 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1010876894 6:81117693-81117715 GCGGCCGGGAAGCTTGAACTGGG - Intergenic
1010997646 6:82551659-82551681 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
1011283458 6:85700393-85700415 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
1011533539 6:88351294-88351316 GCAGCCAGGAAGCTCGAACCGGG + Intergenic
1012317179 6:97795115-97795137 GCGGCTGGGAAGCTCGAACAGGG + Intergenic
1012367552 6:98460744-98460766 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
1012595188 6:101030964-101030986 GCGGCTGGGAAGCTCGAACTGGG - Intergenic
1012654120 6:101793862-101793884 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1012722099 6:102758409-102758431 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1012799062 6:103802313-103802335 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1012941023 6:105415471-105415493 GCAGCAAGGAAGCTTGAACTGGG + Intergenic
1013448901 6:110259460-110259482 GCGGCCAGGAAGCTTGAACTGGG + Intronic
1013878620 6:114865767-114865789 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1014377048 6:120689217-120689239 GCAGCTGGGAAGCTCGGAGCTGG + Intergenic
1014565651 6:122945049-122945071 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1014979237 6:127926682-127926704 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1015024159 6:128513369-128513391 GCTACTTGGAAGCCTGAAGCAGG + Intronic
1015081231 6:129227975-129227997 GTGGCTGGGAAGCTTGAACTGGG - Intronic
1015773702 6:136792912-136792934 GCTGCTAGGAAGCTCGAGCCCGG + Intergenic
1015967687 6:138711576-138711598 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1016365134 6:143307858-143307880 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1017653559 6:156605177-156605199 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1018175776 6:161178281-161178303 GTGGCTGGGAAGCTTGAATTGGG - Intronic
1020619587 7:10501433-10501455 GCAGCCTGGAAGCTTGAACCGGG + Intergenic
1020645660 7:10811549-10811571 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1021143235 7:17053422-17053444 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1021156384 7:17215696-17215718 GTGGCTAGGAAGCTCGAACTGGG + Intergenic
1021388929 7:20068279-20068301 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1021870538 7:25001927-25001949 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1022079731 7:27008095-27008117 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1022360966 7:29656953-29656975 GCTGCTAGGGAGGTTGAGGCAGG - Intergenic
1022879976 7:34576278-34576300 GCGGACAGGAAGCTTGAACTAGG + Intergenic
1023456000 7:40339393-40339415 GCGGCCAGGAAGCTCGAACCAGG - Intronic
1023457607 7:40358600-40358622 GCTACTCGGAAGGTTGAAGCAGG + Intronic
1023600353 7:41876247-41876269 GCTACTTGGAAGCCTGAAGCAGG - Intergenic
1023826966 7:44016057-44016079 GCTACTAGGAAGGCTGAAGCAGG + Intergenic
1024205875 7:47160156-47160178 GTGGCCAGGAAGCTCGAAGTGGG + Intergenic
1024552640 7:50576481-50576503 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1024592357 7:50899320-50899342 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1024667034 7:51557814-51557836 GCAGCTAGGAAGCTTGAACTGGG - Intergenic
1024671470 7:51599650-51599672 GCGGCCAGGAAACTTGAATTGGG - Intergenic
1024738222 7:52328464-52328486 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1025255995 7:57384244-57384266 GCGGCTCAGAAGCTTCTAGCTGG + Intergenic
1027380848 7:77607863-77607885 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
1027495971 7:78888223-78888245 GCGGCCAGGAAGCTCGAATTGGG + Intronic
1027727825 7:81829689-81829711 GCAGCCAGGAAGCTTGAACAGGG - Intergenic
1027921709 7:84403390-84403412 GCGGCTGGGAAGCTTGAACTGGG + Intronic
1028013576 7:85679492-85679514 GCAGCCAGGAAGCTTGAATTGGG - Intergenic
1028646942 7:93108794-93108816 GTGGCCAGGAAGCTTGAACTGGG + Intronic
1028895858 7:96040831-96040853 GCTGCTAGGGAGGTTGAGGCAGG - Intronic
1028916278 7:96263108-96263130 GAGGCAAGGAAGCTTGGAGAGGG - Intronic
1029062297 7:97810829-97810851 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1029738119 7:102475808-102475830 GCTACTAGGAAGGCTGAAGCAGG + Intronic
1029755252 7:102569458-102569480 GCTACTAGGAAGGCTGAAGCAGG + Intronic
1029773200 7:102668538-102668560 GCTACTAGGAAGGCTGAAGCAGG + Intronic
1029965471 7:104735364-104735386 GCGGCTGGGAAGCTCGAACTGGG - Intronic
1030142628 7:106320635-106320657 GAGGCTAGGAAGCTCGAACTGGG + Intergenic
1030392349 7:108943184-108943206 GCGGCACGGAAGCTCGAAACGGG - Intergenic
1030467817 7:109924732-109924754 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1031699062 7:124900991-124901013 GCGGCTGGGAAGCTTGAACTGGG + Intronic
1032771863 7:135067230-135067252 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1033107077 7:138536862-138536884 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1033129835 7:138736132-138736154 GCTGCTTGGAAGGCTGAAGCAGG + Intronic
1033902279 7:146157728-146157750 GTGGCCAGGAAGCTTGAACTGGG + Intronic
1034723957 7:153318249-153318271 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1034886539 7:154803042-154803064 GAGGCTGGGGAGTTTGAAGCAGG - Intronic
1036804480 8:11820504-11820526 GCAGCAAGGAAGCTTGAACTGGG - Intronic
1038928981 8:32171840-32171862 GCGGCCAGGAAGCTCGAACTGGG + Intronic
1039103652 8:33967364-33967386 GCGGCCAGGAAGCTCGAACTCGG - Intergenic
1039154577 8:34540713-34540735 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1039522022 8:38179266-38179288 GCTACTAGGAAGGCTGAAGCAGG - Intronic
1039601766 8:38845034-38845056 GCTGCTCGGAAGGCTGAAGCAGG - Intronic
1039850084 8:41357583-41357605 GCGGCCTGGAAGCTTGAACTGGG - Intergenic
1040083444 8:43312810-43312832 GCAGCCAGGAAGCTTGAACTCGG - Intergenic
1040403415 8:47075992-47076014 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1040434331 8:47375351-47375373 GCTACTTGGAAGGTTGAAGCAGG - Intronic
1040612383 8:48998089-48998111 GTGGCTGGGAAGCTGGAACCGGG + Intergenic
1041035589 8:53786185-53786207 GCGGCCTGGAAGCTTGAACTGGG - Intronic
1041294254 8:56338407-56338429 GCGGCCAGGAAGTTTGAACTGGG - Intergenic
1041314898 8:56550792-56550814 GCGGCTAGGAAACTTGAACTGGG + Intergenic
1041634737 8:60130318-60130340 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1041815734 8:61968704-61968726 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1041998784 8:64096084-64096106 GCTACTAGGTAGGTTGAAGCTGG + Intergenic
1042072880 8:64956044-64956066 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1042235973 8:66613388-66613410 GGGGCTGGGGAGCTGGAAGCTGG + Intronic
1042630323 8:70808789-70808811 GAGGCCAGGAAGCTTGAACTGGG + Intergenic
1042682255 8:71398942-71398964 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1042720368 8:71820740-71820762 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1043129383 8:76442071-76442093 GCGGCAGGGAAGCTTGAACTGGG - Intergenic
1043165823 8:76901749-76901771 GCGACCAGGAAGCTTGAACTGGG - Intergenic
1043177617 8:77042336-77042358 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1043497942 8:80823414-80823436 ACGGCTGGGAAGCTCGAACCTGG + Intronic
1043605121 8:81990756-81990778 GCGGCTAGGAAGCTGGAACTGGG - Intergenic
1043726927 8:83622987-83623009 GCGGCCGGGAAGCTTGAACTAGG - Intergenic
1043760228 8:84059090-84059112 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1043787865 8:84425077-84425099 GCAGCTAGGAAGCTCGAACTGGG - Intronic
1044060082 8:87625284-87625306 GCAGCTGGGAAGCTCGAAGTGGG + Intergenic
1044225007 8:89708663-89708685 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1044597005 8:93969486-93969508 GCAGCCAGGAAGCTTGAACAGGG - Intergenic
1044601441 8:94009269-94009291 GCGGCCAGGAAGCTGGAACTGGG - Intergenic
1044843331 8:96356621-96356643 GAGGCAGGGAAGCTGGAAGCAGG + Intergenic
1045143526 8:99313815-99313837 GCGGCCAGGAAGCTTGAACTGGG - Intronic
1045276008 8:100706403-100706425 GCTGCTAGGAAGGCTGAGGCAGG - Intronic
1045450271 8:102317427-102317449 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1045618913 8:103951979-103952001 GCGGCCAGGAAGTTTGAACTGGG + Intronic
1045709271 8:104964340-104964362 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1045802469 8:106117619-106117641 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1046030616 8:108779345-108779367 CTGGCTAGGAAGCCTGAAGATGG + Intronic
1046115223 8:109776614-109776636 GTGGCTTGGAAGCTTGAACTGGG - Intergenic
1046524836 8:115370828-115370850 GCGGCCAGGAAGCTGGAACGGGG + Intergenic
1046798504 8:118398285-118398307 GCTACTAGGAAGGTTGAGGCAGG + Intronic
1047473417 8:125201848-125201870 GCGGCTGAGAAGCTTGAACTTGG - Intronic
1047872313 8:129097629-129097651 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
1048185597 8:132237662-132237684 GAGGCCAGGAAGCTTAAGGCTGG + Intronic
1049312545 8:141940960-141940982 GCGGGCAAGATGCTTGAAGCAGG - Intergenic
1049750346 8:144280161-144280183 GGGGCCAAGAAGCTTGGAGCTGG + Intronic
1050034843 9:1424392-1424414 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1050083183 9:1936712-1936734 GCGGCCTGGAAGCTTGAACTGGG - Intergenic
1050372264 9:4933930-4933952 GCTACTAGGAAGGCTGAAGCAGG - Intergenic
1050447735 9:5743908-5743930 GCTACTTGGAAGCTTGAGGCAGG - Intronic
1050591060 9:7160985-7161007 GCGGCTGGGAAGCTTGAACTGGG - Intergenic
1051286104 9:15498302-15498324 GCCACTAGGAAGCCTGAAGCAGG + Intronic
1051299043 9:15628517-15628539 GCAGCTGGGAAGCTTGAATTGGG + Intronic
1051913122 9:22177505-22177527 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1051917533 9:22225978-22226000 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1051941294 9:22508516-22508538 GTAGCCAGGAAGCTTGAAGTGGG - Intergenic
1053041668 9:34878708-34878730 GCGGCTAGAAAGCTCGAAATGGG + Intergenic
1053751705 9:41263659-41263681 GTGGCCAGGAAGCTTGAACAGGG - Intergenic
1054257232 9:62827988-62828010 GTGGCCAGGAAGCTTGAACAGGG - Intergenic
1054334082 9:63787737-63787759 GTGGCCAGGAAGCTTGAACAGGG + Intergenic
1054959929 9:70956772-70956794 GCTGCTAGGAAGGCTGAGGCAGG + Intronic
1055853939 9:80663831-80663853 GTGGCTAGGAAGCTCGAAATGGG - Intergenic
1056582549 9:87902613-87902635 GTGGCTAGGAAGCTCGAACTGGG + Intergenic
1056861885 9:90192669-90192691 GCGGCCAGGAAGCTGGAAATGGG + Intergenic
1056909631 9:90686752-90686774 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1057109597 9:92455276-92455298 GCTACTTGGAAGCCTGAAGCAGG + Intronic
1057163134 9:92905572-92905594 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1057322339 9:94025995-94026017 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1057698127 9:97341836-97341858 GCGGCCAGGAAGCTTGAACTGGG - Intronic
1058081939 9:100710088-100710110 GCAGCTGGGAAGCTTGAATTGGG - Intergenic
1058796295 9:108501569-108501591 GCAGCCAGGAAGCTCGAACCGGG + Intergenic
1058962541 9:110005673-110005695 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1059005117 9:110393851-110393873 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1061522385 9:131126657-131126679 GCTACTAGGGAGGTTGAAGCAGG - Intronic
1203475326 Un_GL000220v1:145028-145050 GCTGCTAGGAAGGCTGAGGCAGG + Intergenic
1203370775 Un_KI270442v1:302472-302494 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1186743083 X:12538321-12538343 GCGGCCAGGAAGCTCGAAATGGG + Intronic
1186775830 X:12863942-12863964 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1186956555 X:14688448-14688470 GCGGCCTGGAAGCTTGAACTGGG - Intronic
1187595814 X:20771628-20771650 GCGGCTGGGAAGCTCGAACTGGG + Intergenic
1187623946 X:21089656-21089678 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1187921710 X:24209685-24209707 GCCGCTTGGAAGGTTGAGGCAGG - Intronic
1188043972 X:25404247-25404269 GCAGCTGGGAAGCTTGAACAGGG - Intergenic
1188054153 X:25522323-25522345 GCGGGTAGGAAGCATCCAGCAGG - Intergenic
1188658629 X:32731376-32731398 GCAGCTGGGAAGCTTGAACTGGG + Intronic
1188940818 X:36235270-36235292 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1189062469 X:37769090-37769112 GTGGCCAGGAAGCTTGAACTGGG + Intronic
1189499674 X:41544787-41544809 GCTACTAGGAAGGCTGAAGCAGG + Intronic
1189603459 X:42651206-42651228 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1189939262 X:46104340-46104362 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1189970688 X:46415538-46415560 GCAGCCAGGAAGCTCGAAGTTGG - Intergenic
1190209583 X:48433927-48433949 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1190649056 X:52551215-52551237 GAGGCTCGGAAGCTTGAACTGGG + Intergenic
1190966123 X:55303291-55303313 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
1190975562 X:55396994-55397016 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1191012423 X:55774560-55774582 GTGGCTAGGAAGCTCGAACTGGG - Intergenic
1191023640 X:55889639-55889661 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1191076662 X:56460847-56460869 GCGGCCGGGAAGCTTGAACTGGG - Intergenic
1191192794 X:57684747-57684769 GCAGCCAGGAAGCTTGAAATGGG + Intergenic
1191205361 X:57827858-57827880 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1191589904 X:62870864-62870886 GTGGCTAGGAAGCTCGAACTGGG - Intergenic
1191610185 X:63103378-63103400 GCAGCTGGGAAGCTTGAACTGGG + Intergenic
1191625534 X:63266722-63266744 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1191698895 X:64018787-64018809 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1191704918 X:64084506-64084528 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1191765634 X:64695488-64695510 GCAGCCAGGAAGCTCGAAGTGGG - Intergenic
1191993535 X:67065639-67065661 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1192136183 X:68602739-68602761 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1192667070 X:73099582-73099604 GCGGCCAGGAAGCTTGAACTGGG - Intergenic
1192843157 X:74878516-74878538 GCAGCCAGGAAGCTTGAACTGGG - Intronic
1192871793 X:75191610-75191632 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1192912210 X:75616879-75616901 GTGGCTAGGAAGCTCGAAGTGGG + Intergenic
1192954300 X:76052441-76052463 GCGGCCAGGAAGCTCGAACTAGG - Intergenic
1192974424 X:76267883-76267905 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1193002967 X:76583483-76583505 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1193004699 X:76602740-76602762 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1193030839 X:76896682-76896704 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
1193035893 X:76950858-76950880 GAGGCCAGGAAGCTTGAACTGGG + Intergenic
1193088717 X:77471111-77471133 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1193592525 X:83407611-83407633 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1193787090 X:85772533-85772555 GCGGCCGGGAAGCTTGAACTGGG - Intergenic
1193806582 X:86002725-86002747 GTGGCCAGGAAGCTTGAACTGGG + Intronic
1194370061 X:93060663-93060685 GTGGCCAGGAAGCTTGAACTGGG + Intergenic
1194658124 X:96598110-96598132 GAGGCCAGGAAGCTTGAACTGGG + Intergenic
1194761737 X:97803562-97803584 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1195098040 X:101524785-101524807 GCAGCCAGGAAGCTTGAACTGGG + Intronic
1195163671 X:102196706-102196728 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1195417531 X:104636490-104636512 GTGGCCAGGAAGCTTGAACTGGG - Intronic
1195440709 X:104895432-104895454 GTGGCCAGGAAGCTTGAACTGGG - Intronic
1195456807 X:105078680-105078702 GCGGCCAGGAAGCTCGAACTGGG - Intronic
1195723562 X:107890765-107890787 GCAGCTGGGAAGCTTGAACTGGG - Intronic
1196896787 X:120344715-120344737 GCGGCCAGGAAGCTCGAACTGGG + Intergenic
1197239677 X:124110037-124110059 GTGGCTGGGAAGCTTGAACTGGG - Intronic
1197667714 X:129241335-129241357 GCAGCCAGGAAGCTTGAACTAGG + Intergenic
1197968988 X:132095204-132095226 GCTGCTAGGAAGGCTGAGGCAGG - Intronic
1198366087 X:135941414-135941436 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1198489323 X:137122898-137122920 CCGGCTGGGAAGCTTGAACTGGG + Intergenic
1199098310 X:143767894-143767916 GCGGCCAGGAAGCTCGAACTGGG - Intergenic
1200023285 X:153230169-153230191 GAGTTTAGGAAGCTTGAAGGTGG - Intergenic
1200204774 X:154307972-154307994 GAGGGTAGGAAGCAAGAAGCAGG + Intronic
1200222905 X:154400598-154400620 GCGGCCAGGAAACTTGAACTTGG - Exonic
1200288518 X:154848434-154848456 GCGGCCAGGAAGCTCGAACTTGG - Intronic
1200378492 X:155809250-155809272 GCGGCCAGGAAGCTTGAACTGGG + Intergenic
1200384612 X:155878097-155878119 GCTACTAGGAAGGTTGAGGCGGG + Intergenic
1200388478 X:155918071-155918093 GTGGCCAGGAAGTTTGAACCGGG - Intronic
1200400712 X:156018924-156018946 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
1200567817 Y:4788662-4788684 GCTACTAGGAAGTCTGAAGCAGG - Intergenic
1200678248 Y:6176868-6176890 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
1200689674 Y:6294406-6294428 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1201045598 Y:9880314-9880336 GCAGCCAGGAAGCTTGAACTGGG + Intergenic
1201244903 Y:11993979-11994001 GCAGCCAGGAAGCTTGAACTGGG - Intergenic
1201522229 Y:14888180-14888202 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1201778777 Y:17695707-17695729 GTGGCTGGGAAGCTTGAACTGGG - Intergenic
1201822779 Y:18210285-18210307 GTGGCTGGGAAGCTTGAACTGGG + Intergenic
1201956517 Y:19629809-19629831 GTGGCCAGGAAGCTTGAACTGGG - Intergenic
1201988285 Y:19993516-19993538 GCAGCTGGGAAGCTTGAACTGGG - Intergenic
1202022247 Y:20477638-20477660 GTGGCTGGGAAGCTTGAATTGGG + Intergenic
1202331373 Y:23756760-23756782 GCGGCCAGGAAGCTTGAATTGGG + Intergenic
1202539397 Y:25913300-25913322 GCGGCCAGGAAGCTTGAATTGGG - Intergenic