ID: 944522110

View in Genome Browser
Species Human (GRCh38)
Location 2:200582320-200582342
Sequence ATTCACAACCCTATGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944522104_944522110 17 Left 944522104 2:200582280-200582302 CCTGAAGATATTTGTCTAACTAG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 944522110 2:200582320-200582342 ATTCACAACCCTATGGGGCTAGG 0: 1
1: 0
2: 0
3: 14
4: 85
944522103_944522110 23 Left 944522103 2:200582274-200582296 CCTTATCCTGAAGATATTTGTCT 0: 1
1: 0
2: 1
3: 22
4: 271
Right 944522110 2:200582320-200582342 ATTCACAACCCTATGGGGCTAGG 0: 1
1: 0
2: 0
3: 14
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944522110 Original CRISPR ATTCACAACCCTATGGGGCT AGG Intronic
903851541 1:26309679-26309701 CTTAACAACTCTATGAGGCTGGG + Intronic
910134520 1:83951401-83951423 ATACACAAACCCATGAGGCTAGG + Intronic
914843447 1:151266635-151266657 ATCCTCATCCCTCTGGGGCTGGG + Intronic
915005495 1:152631058-152631080 AGTCACAGCATTATGGGGCTTGG + Intergenic
919811706 1:201412869-201412891 ATCTCCAGCCCTATGGGGCTAGG + Intronic
919931435 1:202223829-202223851 TTTCACAGGCCTGTGGGGCTGGG - Intronic
921379874 1:214513608-214513630 ATCCAAATGCCTATGGGGCTAGG - Intronic
924605681 1:245532780-245532802 ATTGAAAAGCATATGGGGCTGGG - Intronic
1072301481 10:94066436-94066458 ATTCACAGTGTTATGGGGCTTGG + Intronic
1074443378 10:113497976-113497998 ATTCAGAACCCTGTTGGGGTAGG - Intergenic
1075964923 10:126603211-126603233 ACTCACAACCCCTTAGGGCTGGG + Intronic
1079083243 11:17428388-17428410 GTTCACAACCCTGAGGGGCTGGG + Exonic
1081993103 11:47348006-47348028 ATTCATGACCCCATGAGGCTGGG + Intronic
1088979601 11:114850202-114850224 CTTCCCAACCCAATGGGGTTGGG - Intergenic
1090383645 11:126344068-126344090 ATCCACCATCCTAAGGGGCTGGG + Intronic
1095097743 12:38157241-38157263 CTCCACAACCCTATTGGGCAGGG - Intergenic
1096271948 12:50172443-50172465 ATTGAAAATCCCATGGGGCTGGG - Intergenic
1097202827 12:57294087-57294109 CTTCACAACCCAATGAGGATGGG - Intronic
1106333559 13:28762782-28762804 ATTTACAACACTGAGGGGCTGGG - Intergenic
1107183049 13:37484699-37484721 ACTCACAATTCTATGTGGCTGGG + Intergenic
1108332244 13:49399684-49399706 ATTTACATTCCTATGGGCCTGGG + Intronic
1116055657 14:39861280-39861302 TTTGACAATCCTATGGGGTTAGG - Intergenic
1120017198 14:79487508-79487530 ACTCAAAACCCTATGCAGCTGGG + Intronic
1124339337 15:28879854-28879876 AGACACATCCCTGTGGGGCTAGG + Intergenic
1124787406 15:32694324-32694346 GTTCAAAGCCATATGGGGCTTGG - Intronic
1125396121 15:39249855-39249877 ATTCGCAAACTTTTGGGGCTCGG + Intergenic
1125577859 15:40767472-40767494 ATTCACTGCCCTTTGGGGCTGGG - Exonic
1135547329 16:23375013-23375035 AGTCATGACCCTCTGGGGCTTGG - Intronic
1136135709 16:28255811-28255833 AATGACAACCCCATGGGGCTGGG + Intergenic
1137008963 16:35304794-35304816 ATTCACATCACTATGGTGCTGGG + Intergenic
1137027858 16:35496469-35496491 ATTCACATCACTATGGTGCTGGG + Intergenic
1138218553 16:55227453-55227475 ATTCTCATCCACATGGGGCTGGG - Intergenic
1139240394 16:65385683-65385705 ATTCAAAACCTTTTGAGGCTTGG - Intergenic
1139700709 16:68706433-68706455 ATTGACCACCCCATGGGCCTTGG + Intronic
1146685349 17:34837705-34837727 ATTCAAAACCCTCTGGGATTTGG - Intergenic
1147584157 17:41643433-41643455 ATCCACAGCCCCATGGGCCTGGG + Intergenic
1148753144 17:49957482-49957504 CTTCACAACCCTGTGAGGTTGGG + Intergenic
1148846293 17:50532161-50532183 AGTCATAACCATTTGGGGCTGGG + Intergenic
1155932616 18:31723656-31723678 ATTCACCACCCTATTAGGCAGGG - Intergenic
1162288502 19:9759994-9760016 GTTTAAAAGCCTATGGGGCTGGG + Intronic
926611617 2:14953526-14953548 ATCCACCACTCCATGGGGCTAGG - Intergenic
927149690 2:20188433-20188455 ATTCACAGCCCACTGGGGCTTGG - Intergenic
936623119 2:114120628-114120650 ATTCCCCAGCCTATGGGGGTAGG - Intergenic
937496816 2:122429228-122429250 CTTCACAACCCTGTGGCCCTAGG + Intergenic
939627699 2:144498400-144498422 ATCCGCAACCACATGGGGCTTGG - Intronic
944522110 2:200582320-200582342 ATTCACAACCCTATGGGGCTAGG + Intronic
945030605 2:205660053-205660075 AATCACCATCCTGTGGGGCTGGG + Intergenic
948223020 2:236288483-236288505 ATTCACAACTCTGCAGGGCTGGG + Intergenic
1172160899 20:32867213-32867235 ATTCAGAACCCCAGGGGGCTGGG - Intronic
1175950789 20:62582019-62582041 ATTCACCACCCTCGCGGGCTGGG - Intergenic
1182470690 22:30546497-30546519 CTTCCCAACCCTGAGGGGCTTGG - Intronic
950007932 3:9703642-9703664 ATGGACAACTCTAGGGGGCTTGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
955823250 3:62918858-62918880 AATCACAATCCTTTGGGGCTAGG - Intergenic
957375667 3:79354244-79354266 AACCACAACCCTATGTGGCAAGG + Intronic
957547030 3:81652213-81652235 AGTGTCACCCCTATGGGGCTTGG + Intronic
962921510 3:139954361-139954383 CTTCACATCCATCTGGGGCTAGG + Intronic
964742759 3:159984649-159984671 AATTAAAACCCTTTGGGGCTGGG - Intergenic
964768948 3:160204459-160204481 ATTCACAATTCCATGTGGCTGGG + Intergenic
970131276 4:12874749-12874771 ATTCAGCACCCTTTGGGGCAAGG + Intergenic
971410064 4:26360903-26360925 ATTAAAAACCCTATGAGGCCGGG - Intronic
976982183 4:91244605-91244627 ATTCACAGCATTATAGGGCTTGG + Intronic
977487401 4:97665970-97665992 ACTTACAAGCCTATGGGGGTAGG + Intronic
978329544 4:107597787-107597809 ATTCACAACCCTATGGTGGAAGG - Intronic
981841926 4:149123045-149123067 CTCCACAATCCTATAGGGCTAGG + Intergenic
984867660 4:184295970-184295992 ATCTACATCCCTATGGGGCAAGG - Intergenic
986769601 5:10960019-10960041 ATTCACAGTTCTATGTGGCTGGG - Intergenic
991173336 5:63654754-63654776 AGCCACAACCCTATTGGGGTAGG - Intergenic
991470546 5:66964504-66964526 AATCCTAATCCTATGGGGCTGGG + Intronic
994117434 5:96076447-96076469 CTTCATAACCCTAAGGGGCTCGG + Intergenic
1002044133 5:176532507-176532529 ACTCACAACCCTAGGAGGCAAGG + Exonic
1004411052 6:15381986-15382008 TTTAACAACCAAATGGGGCTGGG + Intronic
1005162209 6:22876813-22876835 AGACACAACCCTATGGCTCTTGG + Intergenic
1005197724 6:23308920-23308942 ATTCATAATCCAATGGGGATTGG - Intergenic
1007312052 6:40954464-40954486 ATCCTGAACCTTATGGGGCTGGG + Intergenic
1009465071 6:63958987-63959009 ATTCAGAAGCCTATGGGTCCAGG + Intronic
1009824940 6:68856135-68856157 ATTCACAGTCCCATGTGGCTGGG - Intronic
1011137564 6:84116454-84116476 ATTCACAATTCTATGTGGCTGGG - Intergenic
1015563069 6:134537297-134537319 ATTCACATGCCGATGGTGCTGGG - Intergenic
1016050720 6:139527395-139527417 ATTCAGCACCCTTTGGGGCTGGG - Intergenic
1023957823 7:44901849-44901871 ATTCACAACCCTATGCCCATGGG - Intergenic
1025161078 7:56661387-56661409 ATTCACATCACTATGGTGCTGGG - Intergenic
1025750130 7:64286699-64286721 ATTCACATCACTATGGTGCTGGG + Intergenic
1027949994 7:84803532-84803554 ATTCATTACCCCATGGGACTAGG - Intergenic
1030742089 7:113121609-113121631 ATTAACAACCCTATGAAGATTGG - Intergenic
1035851914 8:2928866-2928888 GTTAGCAACCCTGTGGGGCTAGG - Intergenic
1037537187 8:19835727-19835749 CTTCACAACCCTGTGGGCATAGG + Intronic
1038634321 8:29273168-29273190 AGTCACAACCCTGTGGGTTTAGG + Intergenic
1041567018 8:59290183-59290205 CTTCAAAACTCTATGGGGCAAGG + Intergenic
1042850589 8:73212272-73212294 AGGCACAACCCCATGGTGCTTGG - Intergenic
1044233011 8:89800777-89800799 ATTCCCCAGCCTGTGGGGCTTGG + Intergenic
1044547277 8:93473821-93473843 ATTCATCTCCCTATGGGGGTAGG + Intergenic
1046071761 8:109263699-109263721 ATGCAGAACCCTATTGGGTTGGG + Intronic
1048419484 8:134262653-134262675 ACTCACAATTCTATGTGGCTGGG - Intergenic
1055627937 9:78193877-78193899 ACTCACAGCTCTATGCGGCTGGG + Intergenic
1058614061 9:106807073-106807095 ACTCACAATTCTATGTGGCTGGG - Intergenic
1060946121 9:127569917-127569939 AGGCACCAGCCTATGGGGCTGGG + Intronic
1189278117 X:39802035-39802057 AATTACGACCCTATTGGGCTCGG - Intergenic
1189659803 X:43285365-43285387 GATCACAGGCCTATGGGGCTAGG + Intergenic
1190763074 X:53452594-53452616 CTTCACAACTCTATGAGGATGGG + Intergenic