ID: 944525827

View in Genome Browser
Species Human (GRCh38)
Location 2:200618679-200618701
Sequence ACTCACTACCCAACTACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944525827_944525832 14 Left 944525827 2:200618679-200618701 CCTTAAGTAGTTGGGTAGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 944525832 2:200618716-200618738 TCGAGTTCCTGGAGCAGCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 169
944525827_944525833 15 Left 944525827 2:200618679-200618701 CCTTAAGTAGTTGGGTAGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 944525833 2:200618717-200618739 CGAGTTCCTGGAGCAGCAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 213
944525827_944525835 21 Left 944525827 2:200618679-200618701 CCTTAAGTAGTTGGGTAGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 944525835 2:200618723-200618745 CCTGGAGCAGCAGAGGGCACTGG 0: 1
1: 0
2: 6
3: 75
4: 564
944525827_944525831 3 Left 944525827 2:200618679-200618701 CCTTAAGTAGTTGGGTAGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 944525831 2:200618705-200618727 GAGCACTCTTCTCGAGTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944525827 Original CRISPR ACTCACTACCCAACTACTTA AGG (reversed) Intronic
901270636 1:7950782-7950804 ACTCACTCCACAATTATTTATGG - Intergenic
908406768 1:63821873-63821895 ACTCACTCCCCAGCCACTTGAGG - Intronic
910358863 1:86395318-86395340 ACTCACTAACCACCTACATTCGG + Intronic
920251073 1:204622829-204622851 ACTCACTACCCAAGTACCTGAGG + Intronic
920657183 1:207885916-207885938 ACTCCCTCCCCAACTTCCTATGG + Intronic
1068327780 10:55517060-55517082 ACTCACTAAAGAACTACTAAGGG + Intronic
1069305045 10:66958720-66958742 ACTCACTATCCTACTACTCCTGG + Intronic
1072462693 10:95634461-95634483 ACTCACTCACCAAATATTTAAGG - Intronic
1073083195 10:100872708-100872730 ACTAATTTCCCAACTACTCATGG - Intergenic
1073219258 10:101856159-101856181 AATGACTACCCAGCTCCTTAGGG + Intronic
1073761855 10:106637789-106637811 ACTAAATACCCAAATACTTCTGG + Intronic
1074130663 10:110570902-110570924 TCTCAGTACCTAACTACTTTTGG - Intronic
1079743372 11:24093263-24093285 GCTCATTAACCAACTAATTACGG - Intergenic
1085235710 11:75013611-75013633 AGTCCCTTCCCAACTACTTGGGG - Intronic
1086645884 11:89219691-89219713 ACCCAATACCCACATACTTATGG - Intronic
1087381993 11:97417060-97417082 ACTCACTACCTGAGCACTTATGG - Intergenic
1091636259 12:2199165-2199187 CCTCACTACCCAATTTCTTTTGG + Intronic
1096250180 12:50026234-50026256 ACTCACTACTCAACAACGCATGG + Intronic
1097930632 12:65180831-65180853 ACTTACTACCCAATTAGTTCAGG - Intronic
1099530826 12:83778537-83778559 ACTCAATCCCCTACTTCTTATGG + Intergenic
1100920440 12:99478604-99478626 ACTCACTACACAAATATTTCTGG - Intronic
1101807792 12:108079999-108080021 ACTCTCCACCCAACTCATTAAGG - Intergenic
1104091640 12:125522630-125522652 ACTTGCTACCAAACTACTGAAGG + Intronic
1109706041 13:66094212-66094234 ACTCACCAGCCACCTTCTTAAGG + Intergenic
1117275599 14:54190206-54190228 AGCCACTACCCAAACACTTATGG + Intergenic
1117556778 14:56894279-56894301 ACTCACCACCCATCTGCTCAGGG + Intergenic
1117813172 14:59570095-59570117 ACTCACTACAAAACTACCCAAGG + Intronic
1121642662 14:95496077-95496099 ACTCTCTGCCCATCCACTTAGGG - Intergenic
1138196225 16:55054250-55054272 ACACACTACACAACTGCATATGG + Intergenic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1140794791 16:78427101-78427123 GCTCACTACCCAAGAACTCAGGG + Intronic
1146415935 17:32633012-32633034 ACATACTACCAAACTACTCATGG + Intronic
1154228997 18:12536662-12536684 AATCCCCACCCAACTACTTGTGG + Intronic
1158532554 18:58276749-58276771 ACCCATTCCCAAACTACTTAAGG + Intronic
926453650 2:13038320-13038342 ACTTACTAGCCTACTACTTTGGG + Intergenic
926976100 2:18518536-18518558 GCTTACTATCCCACTACTTACGG - Intergenic
941757819 2:169206875-169206897 AGTCGTTACCCAACTCCTTATGG - Exonic
944525827 2:200618679-200618701 ACTCACTACCCAACTACTTAAGG - Intronic
948052285 2:234987766-234987788 ACTCACTGCCCAATCACTTCTGG - Intronic
1171113209 20:22502712-22502734 TCTCTCTTCCCAACTCCTTATGG - Intergenic
1178600652 21:33991663-33991685 ACTCATTAGCAAACTAATTAAGG + Intergenic
1185124060 22:48994982-48995004 ATTCATTCCACAACTACTTAAGG + Intergenic
951048984 3:18073244-18073266 ACACACTACCCTTCTACATAAGG - Intronic
954065445 3:48102345-48102367 ACTCATTACCCAAATAGTGAAGG + Intergenic
960261834 3:115577040-115577062 AACCACTTCCCAACTCCTTATGG + Intergenic
965692004 3:171367405-171367427 ACTCCCTACCTACCTATTTAAGG - Intronic
975047130 4:69819538-69819560 ACTCACAACCAAAGTACGTATGG + Intronic
978723989 4:111948338-111948360 ACTCACTTCCATACTACTAAAGG - Intergenic
984152666 4:176153417-176153439 AGTCACTACCCATCTACTAAAGG - Intronic
987998753 5:25320994-25321016 ACTCAATACACATTTACTTATGG + Intergenic
995396978 5:111697342-111697364 ACTCACTTCCCAAATACCTCTGG + Intronic
996493846 5:124130456-124130478 ACTCTGTACCAAACTACTTGGGG - Intergenic
1004119035 6:12801385-12801407 CTTCACTACCCAACTATGTATGG + Intronic
1005951528 6:30635062-30635084 TCACACAAACCAACTACTTATGG - Intronic
1007335939 6:41154938-41154960 ATTCAATAACCAACTAGTTAAGG - Intergenic
1014082259 6:117301416-117301438 ACTCAACACTCAACTACTCAAGG + Intronic
1017031257 6:150224871-150224893 CCTTACTACCACACTACTTAAGG - Intronic
1031074921 7:117202723-117202745 ACTCACTTCCCAATTGCCTATGG + Intronic
1031636022 7:124102083-124102105 ACTCACTAACAAACTAGTTCTGG - Intergenic
1034897922 7:154889485-154889507 ACTCATTACACAACTAATTAGGG + Exonic
1038137585 8:24805124-24805146 ACTCTCTTCCCAATTACATAAGG + Intergenic
1040871791 8:52107250-52107272 ACTCACTCCCCACCCACATAGGG + Intergenic
1043883569 8:85572978-85573000 AATCAGCACCCAAATACTTACGG + Intergenic
1049823154 8:144648453-144648475 CCTCACTACAGAACTACTGAAGG + Intergenic
1050142416 9:2530153-2530175 ACTCAGTACCCAAGTGCCTAGGG - Intergenic
1051293712 9:15572840-15572862 ATTCAATACACAACTACTGACGG - Intronic
1056503524 9:87234270-87234292 AGTCACTGCACAAGTACTTAAGG - Intergenic
1057488443 9:95505040-95505062 ATTAATTACCAAACTACTTAAGG + Intronic
1059355788 9:113698420-113698442 TCTCACTTCCCCACTTCTTAAGG + Intergenic
1186598514 X:11010319-11010341 ACTCCCTACCTAACTACCAATGG + Intergenic
1188805679 X:34585964-34585986 ACACACAACCCAATTATTTAAGG - Intergenic
1196652520 X:118182826-118182848 AATCACTTACCACCTACTTAAGG + Intergenic
1197685490 X:129435477-129435499 TCTTACTACCCAACAACTAAAGG - Intergenic
1199897996 X:152142731-152142753 ACTCACTTCCAAGTTACTTAAGG + Intergenic