ID: 944526462

View in Genome Browser
Species Human (GRCh38)
Location 2:200624752-200624774
Sequence GAGAACATCCTATCATTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944526462_944526463 -5 Left 944526462 2:200624752-200624774 CCATGAAATGATAGGATGTTCTC 0: 1
1: 0
2: 1
3: 11
4: 139
Right 944526463 2:200624770-200624792 TTCTCTTGTGTGCATTCCATTGG 0: 1
1: 0
2: 1
3: 16
4: 188
944526462_944526465 12 Left 944526462 2:200624752-200624774 CCATGAAATGATAGGATGTTCTC 0: 1
1: 0
2: 1
3: 11
4: 139
Right 944526465 2:200624787-200624809 CATTGGTTCTTATAATTTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944526462 Original CRISPR GAGAACATCCTATCATTTCA TGG (reversed) Intronic
902112074 1:14089515-14089537 GACAATATCCTATTATTTGAGGG - Intergenic
903750831 1:25619289-25619311 GAGAGCATCCTCTCGTTTCTAGG - Intronic
906367897 1:45226281-45226303 GACAAAATCCCATCCTTTCATGG + Intronic
911328506 1:96498120-96498142 GATAAGATGATATCATTTCATGG - Intergenic
912552433 1:110492802-110492824 GAGAACATCCCAGGACTTCAAGG + Intergenic
912593799 1:110853776-110853798 GAGATCATCTTTTCATTTCAAGG - Intergenic
913663389 1:121024966-121024988 GAGATCTTTCTATCTTTTCAAGG - Intergenic
914014780 1:143808230-143808252 GAGATCTTTCTATCTTTTCAAGG - Intergenic
914163041 1:145152977-145152999 GAGATCTTTCTATCTTTTCAAGG + Intergenic
914653400 1:149716787-149716809 GAGATCTTTCTATCTTTTCAAGG - Intergenic
915062537 1:153198108-153198130 GAGAATTTCCTATGAGTTCAAGG + Intergenic
920629682 1:207639376-207639398 GAAAACATCCTGTTATTTCAGGG + Exonic
920639515 1:207738383-207738405 GAAAACATCCTGTTATTTTAGGG + Intronic
923622502 1:235589866-235589888 GAGTACATTATCTCATTTCAAGG - Intronic
1063534904 10:6873989-6874011 GAGGACAGGCTATCTTTTCATGG + Intergenic
1065352971 10:24811987-24812009 GAGAACAACATATCAAGTCAGGG - Intergenic
1066644538 10:37592605-37592627 TAGAACATTCTATCATTCCTTGG - Intergenic
1073168472 10:101479795-101479817 GAGTACATCACATCATTGCAAGG + Intronic
1075170828 10:120112172-120112194 GAGAAATTCCTTTCATTGCATGG + Intergenic
1085332487 11:75665751-75665773 GTGAACATTCTACCATCTCATGG + Intronic
1085568954 11:77542520-77542542 GAGAACATTCTATCATTTGTTGG + Intronic
1090404047 11:126466702-126466724 GAGAACATTCTATCATCTGCAGG + Intronic
1094251524 12:28367862-28367884 GGCAACATCCAATCATTTGAAGG + Intronic
1098874154 12:75849566-75849588 GGGAAGATCCTATAATTGCAAGG - Intergenic
1101210865 12:102534171-102534193 CAGAACATCCTCTCCTTTCTAGG - Intergenic
1103975289 12:124698607-124698629 GAGGACATCATTACATTTCATGG + Intergenic
1105350289 13:19608829-19608851 CAGAATTTCCTATCTTTTCAAGG + Intergenic
1107586435 13:41853495-41853517 GAGAAAATCCTATTATGTGATGG - Intronic
1108018167 13:46097525-46097547 CATAACATCCTATCAGATCATGG + Intronic
1108244051 13:48497422-48497444 GAGTACTTCCTATCATTCCTTGG - Intronic
1109487469 13:63046056-63046078 AAGAACATACTCTCAATTCAAGG + Intergenic
1109884108 13:68520395-68520417 GAGAATAAAGTATCATTTCATGG - Intergenic
1110525225 13:76528403-76528425 TAAAACACCCTATTATTTCAAGG - Intergenic
1115972770 14:38964241-38964263 GAGAACATTCTATTTCTTCATGG + Intergenic
1116055700 14:39861668-39861690 AAGAACATCCTCCCTTTTCAAGG - Intergenic
1117737800 14:58785191-58785213 GTGTAGATCCTATCATTTCCAGG + Intergenic
1119032776 14:71205431-71205453 CCTAACATCCTATCATTGCAAGG - Intergenic
1120041452 14:79757855-79757877 GAGACCATCCTATCATCAAAAGG + Intronic
1120047256 14:79821412-79821434 GAGAACATGCCCTCATTTAAAGG + Intronic
1121058428 14:90880446-90880468 GAGAACTTCCTCCCTTTTCAAGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1123786098 15:23675181-23675203 TAGAACTTCCATTCATTTCATGG - Intergenic
1125876178 15:43147380-43147402 GAGAACCTCTTATTATTTCTTGG + Intronic
1131412839 15:92225116-92225138 CAGAACATCCAAGCATTCCATGG - Intergenic
1131729380 15:95263191-95263213 GAGAGAATCCTAACATTTAAAGG + Intergenic
1134637755 16:15805608-15805630 CATAACATCCTTTCTTTTCATGG - Intronic
1139656252 16:68388768-68388790 GAGAAGGGCCTATAATTTCAAGG - Intronic
1140160896 16:72492723-72492745 GAGAACACCTCTTCATTTCAGGG - Intergenic
1140604123 16:76514052-76514074 GAGAACATATTATAAATTCAAGG - Intronic
1140782400 16:78308622-78308644 GAGAACATCCTTCCCTTTCCAGG + Intronic
1141814932 16:86403366-86403388 AAAAAAATCCTTTCATTTCAGGG - Intergenic
1143760928 17:9103704-9103726 GAGAATTTCCTACCATTTTAAGG - Intronic
1146352858 17:32110699-32110721 GAAAACATCCTTTAACTTCAGGG - Intergenic
1153498352 18:5722421-5722443 GAAGACGGCCTATCATTTCAGGG - Intergenic
1157282936 18:46358125-46358147 GACATCAACCTATCTTTTCAGGG + Intronic
1158010588 18:52723137-52723159 GAGAACATCCTATGAATTTCCGG - Intronic
1158736605 18:60089591-60089613 GAGAAAATGCTATCAAATCAAGG - Intergenic
1160632577 18:80257131-80257153 GAGTACGTCCTTTCATTCCATGG + Intergenic
1166272756 19:41726937-41726959 TAGAACTTTCTATCTTTTCATGG - Intronic
927925609 2:27011466-27011488 GAGGACATGGGATCATTTCAAGG - Intronic
927991650 2:27452161-27452183 GACCTCATCCAATCATTTCAAGG + Intronic
928338681 2:30422384-30422406 GAGAACAGACTGGCATTTCAGGG + Intergenic
928922324 2:36538670-36538692 CAGAACATCCTATCCTTTTTAGG - Intronic
933667989 2:84980243-84980265 AAGAACAGCCTATCTTTTCCTGG - Intronic
934687839 2:96334690-96334712 GCAAACATCCTATCATGCCAAGG + Intergenic
935417356 2:102833104-102833126 TGGAACATGCTATGATTTCAGGG + Intronic
935901176 2:107795334-107795356 CAGAACATTCTATCATGGCAAGG - Intergenic
936588054 2:113776008-113776030 GGGTACATCCTATCATTTGTTGG + Intergenic
941093836 2:161212766-161212788 GAGAACAGCCTTTCATTCCTTGG - Intronic
944526462 2:200624752-200624774 GAGAACATCCTATCATTTCATGG - Intronic
946575360 2:221070156-221070178 TAAAACATTCTATCATTACACGG - Intergenic
946828154 2:223700317-223700339 GAGAGCATGTTATCATCTCATGG - Intergenic
1169701359 20:8450646-8450668 GAGATCATGCTTTCATTACAAGG - Intronic
1169777572 20:9272749-9272771 AAGAACATCTTTTCATTTTAAGG - Intronic
1172566880 20:35937658-35937680 GAGAACCTCCTTTCCTTTCCAGG - Intronic
1175705909 20:61176467-61176489 CAGAACATCCTTTCTTTTTAAGG - Intergenic
1177403103 21:20631734-20631756 GAGAACAGCCTCCCATTTCCTGG - Intergenic
1177626040 21:23660977-23660999 GACATCATCCAATCATTTGAGGG - Intergenic
1178064272 21:28886532-28886554 GAGAAAATACTGTCATTTCTGGG - Intergenic
1178470877 21:32891606-32891628 GAAAACATCCTAGCATTGGAGGG + Intergenic
1179263228 21:39777250-39777272 GAGAGCATCCTGTCATGTCGTGG + Intronic
1183569727 22:38643833-38643855 GGGAACAACCCATCTTTTCATGG - Intronic
949291450 3:2471438-2471460 TAGAACATGCTATCATTTTAGGG - Intronic
950662536 3:14475497-14475519 GACAAGATCCTCCCATTTCACGG + Intronic
952108415 3:30094973-30094995 TAGAACTTGTTATCATTTCAAGG - Intergenic
953215357 3:40913166-40913188 CAAAACTTCCTTTCATTTCAGGG - Intergenic
954096101 3:48329927-48329949 TAGAACAAGCTATCATTTAAGGG - Intergenic
955101046 3:55850214-55850236 GAGAACATCCTATATTTGGATGG - Intronic
956968904 3:74498190-74498212 GAGAATAATCTTTCATTTCAGGG + Intronic
958074994 3:88665196-88665218 GATAACACCATATCATTTCTTGG + Intergenic
962403953 3:135084311-135084333 GAGCACATCCTTTAATTTCTGGG + Intronic
966024636 3:175260936-175260958 GAGAAAATCCCAACATTGCAGGG + Intronic
969991109 4:11263497-11263519 AAGAAGATCCTATCATTTGGGGG - Intergenic
971131201 4:23812956-23812978 GAGAACATCTTGTCATCTCAAGG + Intronic
971239349 4:24873580-24873602 GAGAACTTCCTTTAATTTCCTGG - Intronic
973288951 4:48450874-48450896 GACCTCATCCAATCATTTCAAGG + Intergenic
975050222 4:69854156-69854178 GAGATCACTCTATCATTTCTTGG + Intronic
976101939 4:81573695-81573717 GAAATCATGCTATTATTTCAAGG - Intronic
977253675 4:94716480-94716502 GAGCTCATGCTATTATTTCATGG + Intergenic
977296980 4:95221293-95221315 GAGAACAACCTAGAATTTTATGG + Intronic
977773081 4:100882358-100882380 GGGAAAATACAATCATTTCATGG + Intergenic
981673818 4:147317722-147317744 GCCCACATCATATCATTTCATGG - Intergenic
982914859 4:161194690-161194712 GAGAACATCCTTTGATTTTAAGG + Intergenic
986271070 5:6231680-6231702 GACAACATTATTTCATTTCATGG + Intergenic
988446824 5:31295976-31295998 GAGAACATCTTATGATTTTAGGG - Intronic
988871239 5:35392342-35392364 GAGATCATCCAATCCCTTCAGGG + Intergenic
989696466 5:44207019-44207041 CAGTACATCCTATAAGTTCATGG - Intergenic
995581336 5:113606234-113606256 TGGGACATCCTTTCATTTCAAGG + Intergenic
995886836 5:116904303-116904325 GACATAAGCCTATCATTTCAAGG + Intergenic
997559532 5:134834341-134834363 GAGAGCCTCCTAGGATTTCAGGG - Intronic
997801471 5:136866786-136866808 TAGAACATCCAGTGATTTCAAGG + Intergenic
998655482 5:144173852-144173874 GAGAACATCCACTAATTTCATGG + Intronic
999494543 5:152084229-152084251 TAGAACTTCCTCTCATTCCAAGG + Intergenic
1010165624 6:72911759-72911781 AAGAACATCCTATGTTTTTATGG + Intronic
1012513904 6:100036391-100036413 TAGAAAATCCTCTCATTTCCTGG + Intergenic
1015245471 6:131069329-131069351 GGGAACTTCCTAATATTTCATGG + Intergenic
1015301080 6:131653786-131653808 AAGGACCTCCTTTCATTTCAAGG - Intronic
1016125759 6:140400703-140400725 GAGAACATAATTTCATTTTATGG - Intergenic
1017533065 6:155316123-155316145 GAGAACATTCAGTCATTACATGG - Intergenic
1020854490 7:13400450-13400472 GAGAACTTGCTATAATTTTAAGG - Intergenic
1022027376 7:26461199-26461221 AAGAACATCCCATCCTATCATGG + Intergenic
1022797142 7:33741228-33741250 CAGAATTTCCTATCATTTTAAGG + Intergenic
1023552565 7:41385809-41385831 GAAATTTTCCTATCATTTCAGGG - Intergenic
1023926477 7:44673538-44673560 GAGAACCTCCTAGCCTTCCAAGG - Intronic
1028392408 7:90332010-90332032 GAGAACATTATATGCTTTCATGG - Intergenic
1031479074 7:122256689-122256711 GAGAGGATCATATCACTTCATGG + Intergenic
1032730323 7:134635498-134635520 GAGGACATAGCATCATTTCATGG + Intergenic
1032866515 7:135930816-135930838 GACAACATCCTACCATCTGAGGG + Intronic
1034026079 7:147706260-147706282 GATATCATCCTATCACTTCCAGG + Intronic
1035170339 7:157013888-157013910 CAGAACATCTGATCATTTTAAGG - Intergenic
1036028347 8:4936451-4936473 CAGAACATCTTATTATTTCAAGG + Intronic
1036395236 8:8364821-8364843 GAGAAGATCCTTACAGTTCAGGG - Intronic
1036427898 8:8663325-8663347 GAAAACAACCTATCATTTCATGG - Intergenic
1039703867 8:39987878-39987900 GAGACCATCATCTCATTTCCTGG + Exonic
1041768137 8:61442020-61442042 CAGAACATTCCATCATTGCAAGG + Intronic
1042113231 8:65403930-65403952 GAGTTCAACATATCATTTCAAGG - Intergenic
1042505859 8:69559567-69559589 GAAATGAGCCTATCATTTCAAGG - Intronic
1046784024 8:118246621-118246643 AAAAACATCATATCATTTCAAGG + Intronic
1051199936 9:14606223-14606245 GAGAACATAATTCCATTTCATGG - Intergenic
1051550949 9:18328847-18328869 GGGGACATCCTGTCATTTCTGGG - Intergenic
1054967638 9:71047635-71047657 GAGTAGATCCAATCATGTCAAGG - Intronic
1055661731 9:78510795-78510817 TAGAGCATCTTTTCATTTCATGG + Intergenic
1057224155 9:93278575-93278597 GAGAAGATCCAATTGTTTCAAGG + Intronic
1060534061 9:124369207-124369229 TACAACTTCCTATCATTTCTTGG + Intronic
1061330531 9:129889637-129889659 GCGAACATCCTCTCCTTTCCAGG - Exonic
1188107441 X:26161314-26161336 GAGAACCTCCGAACATTTGACGG + Intergenic
1188963840 X:36526608-36526630 GAGGAGATTCTTTCATTTCATGG + Intergenic
1189586933 X:42471472-42471494 GAGAACATCCTGGCATTTGAGGG + Intergenic
1193840931 X:86407149-86407171 GAGAACCTATTATAATTTCAAGG + Intronic
1194563933 X:95458414-95458436 GAAAACATCATATAATTTTAAGG - Intergenic
1196759488 X:119188580-119188602 CAGAACATCCCATCACTACAAGG - Intergenic
1197330174 X:125144469-125144491 GAGAACAGCTAAGCATTTCATGG + Intergenic