ID: 944531290

View in Genome Browser
Species Human (GRCh38)
Location 2:200670169-200670191
Sequence GGCGCTGTTGCCAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944531290_944531299 19 Left 944531290 2:200670169-200670191 CCCTCCCCTCTGGCAACAGCGCC 0: 1
1: 0
2: 0
3: 24
4: 238
Right 944531299 2:200670211-200670233 TACCCTCCTTGGATATTTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 134
944531290_944531300 20 Left 944531290 2:200670169-200670191 CCCTCCCCTCTGGCAACAGCGCC 0: 1
1: 0
2: 0
3: 24
4: 238
Right 944531300 2:200670212-200670234 ACCCTCCTTGGATATTTTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 161
944531290_944531304 25 Left 944531290 2:200670169-200670191 CCCTCCCCTCTGGCAACAGCGCC 0: 1
1: 0
2: 0
3: 24
4: 238
Right 944531304 2:200670217-200670239 CCTTGGATATTTTCAGGGACAGG 0: 1
1: 0
2: 1
3: 13
4: 164
944531290_944531298 8 Left 944531290 2:200670169-200670191 CCCTCCCCTCTGGCAACAGCGCC 0: 1
1: 0
2: 0
3: 24
4: 238
Right 944531298 2:200670200-200670222 GCAGACATCTCTACCCTCCTTGG 0: 1
1: 0
2: 0
3: 27
4: 267
944531290_944531305 26 Left 944531290 2:200670169-200670191 CCCTCCCCTCTGGCAACAGCGCC 0: 1
1: 0
2: 0
3: 24
4: 238
Right 944531305 2:200670218-200670240 CTTGGATATTTTCAGGGACAGGG 0: 1
1: 0
2: 4
3: 33
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944531290 Original CRISPR GGCGCTGTTGCCAGAGGGGA GGG (reversed) Intronic
900118369 1:1038227-1038249 GGCCCTGGAGGCAGAGGGGAAGG + Intronic
901449741 1:9328793-9328815 GGCACTGTTGACATAGGGCAGGG + Intronic
901473830 1:9475538-9475560 TGGGCTGTGGGCAGAGGGGAGGG - Intergenic
901772542 1:11537657-11537679 GGGGCTGGTGCCAGAGGGAGAGG + Intergenic
902078770 1:13806829-13806851 GGTGATGTGGGCAGAGGGGAGGG - Intronic
903452124 1:23461262-23461284 AGAGCTGTTGACAGAGGGGGAGG + Intronic
903759202 1:25685924-25685946 GGCTTTGGAGCCAGAGGGGATGG + Intronic
905929601 1:41777827-41777849 TGCGCTCTTCCCAGAGGGCAAGG - Intronic
906621117 1:47280392-47280414 GGCGGTCTTGCCACAGGCGATGG + Exonic
910118768 1:83761334-83761356 GGCTTTGTTGCGAGAGGGGATGG - Intergenic
912313386 1:108645325-108645347 GGAGCTGCTGCCAGATGAGAAGG + Intergenic
913155309 1:116091771-116091793 GGGGCTTTTCCCAGAGGAGACGG - Intergenic
914679563 1:149929635-149929657 GACGCTGCTACCTGAGGGGAAGG - Exonic
916162161 1:161928232-161928254 TACGCTGTTGCCTGAGGGAAAGG - Intronic
920174197 1:204089947-204089969 GGCCATGGTGCCAGAGGGCAGGG + Intronic
920505009 1:206509153-206509175 GAGGCTGCTGCCATAGGGGAAGG - Intronic
920508663 1:206534824-206534846 GATGCTGCTGCCAGAGGCGATGG + Intronic
920805711 1:209231836-209231858 GGCGCTGCTGTCAGCCGGGAGGG - Intergenic
922337248 1:224627770-224627792 GGTGCTGTTGTCAGAGGGAATGG + Intronic
923549583 1:234952766-234952788 GGGGATGTTGACAGTGGGGAAGG - Intergenic
924318367 1:242822117-242822139 GAGGCTATTGCCAGAGGAGAGGG - Intergenic
1067700289 10:48566838-48566860 GGGGCTGTGGCCAGTTGGGAGGG - Intronic
1069907352 10:71739654-71739676 CGCGATGTTGCCAGAGGCCAGGG - Intronic
1070284600 10:75073639-75073661 GCCTCTGTTGCCAGTGGGGGTGG - Intergenic
1071842895 10:89491219-89491241 GGGCCTGCTGGCAGAGGGGATGG + Intronic
1072740463 10:97906090-97906112 GGAGCTCTTGCCAGAAGGCAGGG + Intronic
1073340088 10:102737839-102737861 GGCCTTGTTGGCAAAGGGGAAGG - Exonic
1075539418 10:123299723-123299745 GTGGCTGTGCCCAGAGGGGAGGG + Intergenic
1075835835 10:125452050-125452072 GGCTCCGTACCCAGAGGGGAAGG + Intergenic
1077140233 11:1020961-1020983 GGAGCTGGTGGAAGAGGGGATGG + Intronic
1077211380 11:1372328-1372350 GGCCCGGTTCCCACAGGGGAGGG - Intergenic
1077299342 11:1839965-1839987 GGCACTTTTGCCAGCGGGGAGGG - Intronic
1078932845 11:15926205-15926227 GAGGGTGTTGCCAGAGGAGATGG + Intergenic
1079184889 11:18227818-18227840 GGTGCTGGTGCCAGAGGAGCAGG + Intronic
1079304472 11:19310102-19310124 GGTGCTGTTGCGAGAGGAGGAGG - Intergenic
1081492296 11:43578296-43578318 GAGGCTGTTGACAGAAGGGAAGG - Intronic
1081700290 11:45148165-45148187 GGCTCTATTCCCAGAAGGGAAGG - Intronic
1083289020 11:61679815-61679837 GGCTCTGTCGCCCGTGGGGAAGG + Intergenic
1084169226 11:67392471-67392493 GGCGCTGCTGCCGCAGAGGAGGG - Intronic
1089191073 11:116653726-116653748 GGCCCTGGTGCCTGTGGGGAAGG - Intergenic
1089438589 11:118494551-118494573 GGTGAGGTTGCCAGAGTGGATGG + Intronic
1089695747 11:120215383-120215405 GGCGCAGTTGCTCTAGGGGAGGG + Intronic
1091280004 11:134376356-134376378 GCCACTCTTGCCAGAAGGGAAGG + Intronic
1091450859 12:571152-571174 GGCGCGGTTGCCTGTGGGAAAGG + Intronic
1091599613 12:1909868-1909890 GGCACTGGTGCCAGAGGGCCAGG - Intronic
1092111287 12:5966596-5966618 AGCACAGTGGCCAGAGGGGAGGG - Intronic
1092241976 12:6840911-6840933 GGCTCTGCTGCCAGAGGAGCTGG - Exonic
1092999339 12:13980789-13980811 GGCGCTGCTGCTGGAGGCGATGG - Intergenic
1094621460 12:32084455-32084477 GGCAGTGTTTCCAGTGGGGACGG + Intergenic
1096257781 12:50073519-50073541 GGGGAAGGTGCCAGAGGGGAAGG - Intronic
1096978129 12:55711966-55711988 GGCTCTGTTGCCAGATGAGGTGG - Intronic
1101899886 12:108783940-108783962 AGCTCTCTTGCCAGAGGTGAAGG + Exonic
1102238768 12:111310701-111310723 GGCGTGGTGGCCAGCGGGGACGG - Intronic
1102980571 12:117237802-117237824 GGCACTGGTGAGAGAGGGGAAGG + Intronic
1103851221 12:123934781-123934803 GGCCCTGGTGTCAGAGAGGAGGG - Exonic
1104700363 12:130898391-130898413 GAGGATGTTGCCAGAGGAGATGG - Intergenic
1105426999 13:20302466-20302488 GGCACAGTTGCCAGGAGGGAAGG + Intergenic
1106355193 13:28975479-28975501 GGCGATGCTGCCGCAGGGGAGGG - Intronic
1106568142 13:30904894-30904916 GGGGCTGTTTTCACAGGGGAGGG - Intergenic
1108408113 13:50124652-50124674 GGCGCTGTTGACAGCGGTGCCGG - Intronic
1113114201 13:106857588-106857610 TGCTCTCTTGCAAGAGGGGAAGG - Intergenic
1113381804 13:109811606-109811628 TGCGCTGGAGTCAGAGGGGAGGG - Intergenic
1114242351 14:20880164-20880186 GGTTCTGGTACCAGAGGGGAAGG + Intergenic
1115800475 14:36988076-36988098 GGCCGTGTTGCCACAGGGAAGGG - Intronic
1118439761 14:65801745-65801767 GATGCTGTTGCCAGAAGGAAGGG + Intergenic
1118899486 14:69974460-69974482 GGTTCTGTGGCCAGAGTGGAGGG + Intronic
1120830381 14:88992671-88992693 GGCCCTGCAGCCAGAAGGGAAGG - Intergenic
1121484903 14:94306964-94306986 GGCTCTCTTGGCAGATGGGAGGG + Intronic
1121680115 14:95786746-95786768 CACGCTGTTGGCAGAGAGGAAGG - Intergenic
1122287038 14:100658372-100658394 GGCTCTGTTCCCGGTGGGGAGGG + Intergenic
1122613468 14:103001265-103001287 ACCCCTGTTGCCAGAGGGGCTGG - Intronic
1124155157 15:27219063-27219085 GGGGCTGTAGCCAGAGGAGAAGG - Intronic
1124508327 15:30298361-30298383 ATAGTTGTTGCCAGAGGGGATGG - Intergenic
1124735229 15:32240295-32240317 ATAGTTGTTGCCAGAGGGGATGG + Intergenic
1125578264 15:40769277-40769299 AGCCCGGTAGCCAGAGGGGAAGG + Intronic
1128482773 15:68054399-68054421 GCCGCTGCTGCCAGGGGGGATGG + Intronic
1128534835 15:68482385-68482407 GGAAGTGTGGCCAGAGGGGAGGG + Intergenic
1129184613 15:73898251-73898273 TGCCCTGTGGCCAGAGGGCATGG - Intergenic
1131106131 15:89736208-89736230 GTGGCTGTTGCCAAAGGAGAGGG + Intronic
1132478332 16:153570-153592 GGTCCTGTGGCCAGAGGAGACGG + Intronic
1132480417 16:164160-164182 GGTCCTGTGGCCAGAGGAGACGG + Intronic
1132569297 16:637143-637165 GGCGGGGTTGCCGGAGGGGCGGG + Intronic
1132706218 16:1244559-1244581 GGCGATGTCACCAGTGGGGAGGG - Intergenic
1132937471 16:2488387-2488409 TGCCCTGTGGCCAGAGGGCACGG + Intronic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1134789426 16:16975569-16975591 GGCGTTGTTGTCATAGGAGACGG + Intergenic
1135971939 16:27078701-27078723 GCTGCTGTTGCCAGGGGGAATGG - Intergenic
1135985214 16:27179027-27179049 GCAGCTGTTGCCTCAGGGGAGGG - Intergenic
1136183833 16:28573300-28573322 GGCCCTGAAGCCAGAGGAGAAGG + Intronic
1137796576 16:51225233-51225255 ATCGCTGTAGCCAGAGGGGAGGG + Intergenic
1138023312 16:53503460-53503482 GGCGCTGTTACGTAAGGGGAGGG - Intronic
1138254466 16:55542675-55542697 GGAGATGTTGCCAGAGGGAGTGG + Intronic
1138349224 16:56337665-56337687 GGGGCTGTTGGCAGTGGGGTGGG + Intronic
1141011431 16:80404023-80404045 GGGTCTGTTTCCAGTGGGGAGGG - Intergenic
1144718213 17:17449166-17449188 GGCGTTGCAGCCAGAGGGGCTGG - Intergenic
1144787877 17:17841900-17841922 CAGGCTGGTGCCAGAGGGGAGGG - Intergenic
1146054041 17:29572493-29572515 GGCGCTGCTGCGCGAGGGGCCGG - Exonic
1147318043 17:39630112-39630134 GGAGCTTTTGTCAGTGGGGAGGG + Intronic
1148360773 17:47010402-47010424 GGTGCTGTTCCCAGAAAGGAAGG + Intronic
1149564537 17:57631600-57631622 GGAGCTGTTCCCAGAGTGGTTGG - Intronic
1150785766 17:68161756-68161778 GGTGCTGTTCCCAGAAAGGAAGG - Intergenic
1151535599 17:74737288-74737310 GGCGCCGTTGCCACCCGGGATGG + Intronic
1151573553 17:74939495-74939517 GGTGCTGTTGAGAGTGGGGATGG - Intronic
1152458779 17:80430694-80430716 GGCACTGGTGCCTGAGGGGTTGG + Intronic
1154144929 18:11859565-11859587 GGAGCTGGCTCCAGAGGGGAAGG - Intronic
1155547550 18:26930834-26930856 TGTGCAGTTGGCAGAGGGGAGGG + Intronic
1157601029 18:48893354-48893376 GGCTCTGTTCCGAGAGGGGTTGG + Intergenic
1160227072 18:77019787-77019809 GGTGCTTCTGGCAGAGGGGAAGG + Intronic
1160381729 18:78462485-78462507 GGGGTTGGGGCCAGAGGGGAAGG - Intergenic
1161252063 19:3285720-3285742 GGGGCTATTGCCTGAGGGGCGGG - Intronic
1161312839 19:3604339-3604361 GGCGCTGTTTCCAGAGGCCCGGG + Intronic
1161495143 19:4582270-4582292 GGCGCTGGCGACAGAGGGGCAGG - Intergenic
1161585467 19:5103103-5103125 GGCACTGCTGCCAGTGGGGCCGG + Intronic
1163774160 19:19208244-19208266 GGGGCTGCTGCCAGTGGGGGAGG - Intergenic
1166447540 19:42871387-42871409 GGCACTATTGTCAGAGGGAAGGG + Intronic
1166452004 19:42910199-42910221 GGCGATATTGTCAGAGGGAAGGG + Intronic
1166470400 19:43074979-43075001 GGCACTATTGTCAGAGGGAAGGG + Intronic
1166996687 19:46722868-46722890 GACGGTGTCGCCAGAGCGGAAGG + Exonic
1167246498 19:48376185-48376207 AGGGCTGTTGGCAGAGGGCAAGG - Exonic
1168346118 19:55650981-55651003 TGCGCGGTTCCCATAGGGGAGGG - Intronic
925188417 2:1864863-1864885 GTGGCTGCTGCCAGAGGGGTTGG + Intronic
925344041 2:3157331-3157353 GGAGCCGATGCCGGAGGGGAGGG + Intergenic
925554908 2:5120453-5120475 GGGGCTGTTGCCCCAGGGGCAGG + Intergenic
925755290 2:7127721-7127743 GAGGTTGTTGCCAGAGGAGATGG - Intergenic
926606677 2:14905173-14905195 GAAGATGTTGCCAGAGGAGATGG - Intergenic
928100471 2:28434479-28434501 AGCGCTGTTGCCACGGGGGCAGG + Intergenic
929982688 2:46696758-46696780 GGCGGTGATGCCTGAGGGCAGGG - Intergenic
930244544 2:48969790-48969812 GGTGCTGCTGCCAGAAAGGATGG - Intronic
930726115 2:54683175-54683197 GGTGCTGGTGCCAGGGGGGATGG + Intergenic
931120787 2:59217184-59217206 GGCCTTGTTTCCAGATGGGATGG - Intergenic
932340800 2:70961542-70961564 GGCCCTGTGGCCTGAGGGCAAGG - Intronic
932484875 2:72078668-72078690 GGTGCTGTTGCCAGATTGCAAGG - Intergenic
934683819 2:96305862-96305884 GGGACTGTTGCCAAAGAGGAAGG - Intergenic
934773864 2:96924904-96924926 GGCGCTGGGCTCAGAGGGGAAGG + Intronic
935070373 2:99688759-99688781 GGCGCAGTGGCCTGAGGGGGTGG - Intronic
938834797 2:135089926-135089948 GGACCTGTTGCGGGAGGGGAGGG + Intronic
939674937 2:145060970-145060992 GGTGCTGTGACCAGAAGGGATGG + Intergenic
940197690 2:151114006-151114028 GATGCTGTTGCTAGAGGGCAAGG - Intergenic
941191768 2:162393101-162393123 GGAGTTGTTGCCAGAGTTGATGG + Intronic
943784863 2:191866291-191866313 GGTGCTGTTACCAGAGGTTACGG - Intergenic
944531290 2:200670169-200670191 GGCGCTGTTGCCAGAGGGGAGGG - Intronic
948710906 2:239825032-239825054 GGAGCCGCTGTCAGAGGGGAGGG + Intergenic
1168760613 20:347500-347522 GGCGCGGGTGCCGGTGGGGAAGG + Intronic
1169784908 20:9349294-9349316 AGCGCTGTGGGGAGAGGGGATGG - Intronic
1170320629 20:15093925-15093947 GTGGCTGTTGACAGAGGGCAAGG - Intronic
1172024591 20:31939194-31939216 GGCCCTGTTAGCAGAGAGGAGGG + Exonic
1172624619 20:36340142-36340164 GGCTCTGTTCCCAGAGGTGAGGG - Intronic
1172664686 20:36591028-36591050 GGGGCTGCTGCCACGGGGGAGGG - Exonic
1175280433 20:57800691-57800713 GGTGCTGTTCCCAGAGGAGATGG + Intergenic
1175349635 20:58309304-58309326 GGGGCTGCGGCGAGAGGGGACGG + Intergenic
1175692235 20:61073848-61073870 GGCAGTGTGGCCAGAGGGTAGGG - Intergenic
1176230116 20:64028278-64028300 GGGGCGGTTGCCAGTGGGGCTGG + Intronic
1177107007 21:16969337-16969359 GGCACTGGGGGCAGAGGGGAGGG + Intergenic
1178607744 21:34054496-34054518 GGTGCTGGTGACATAGGGGAAGG + Intergenic
1179011144 21:37557261-37557283 GGCGTTTATGCCAGAGGGGATGG - Intergenic
1180073672 21:45451008-45451030 GGCCCTGTCTCCAGAGGTGATGG - Intronic
1181277835 22:21697597-21697619 GGCGGTGTGGCCAGAGGACAGGG + Exonic
1183315212 22:37133288-37133310 GGAGCTGTGGGCGGAGGGGACGG + Intronic
1183367126 22:37412738-37412760 GGCGCGGCTGCCAGCGGGGTGGG + Intronic
1183668305 22:39257530-39257552 GGCCCTGCTGGCAGAGGGAAGGG - Intergenic
1184210183 22:43030722-43030744 GGCGCTGTTTCCACAGAGGGAGG - Intergenic
1184394069 22:44222258-44222280 GGGGCCGTTGGCTGAGGGGAGGG + Intergenic
1184478566 22:44734756-44734778 GGCCCTGTGGCCAGATGAGATGG - Intronic
1184975543 22:48058915-48058937 GGCTCTGTGGCCAGAGGAGCAGG + Intergenic
1185068517 22:48643826-48643848 GGGGCTGATGTCAGAGGGAAGGG + Intronic
950331522 3:12159490-12159512 GGCTCTGTTGCCTGGGGGGTGGG + Intronic
954326183 3:49865433-49865455 GGCACTCTTGCCAGAGGGAATGG - Intronic
956373624 3:68590540-68590562 GTCGCTGCAGCCAGAGGGGTGGG + Intergenic
958877532 3:99633172-99633194 GAGGGTGTTGCCAGAGGAGATGG + Intergenic
959017786 3:101155128-101155150 GATGCTGTTTCCAGAGGAGATGG - Intergenic
961537566 3:127579286-127579308 GGAGCTGGTACTAGAGGGGAGGG - Intronic
967834313 3:193948012-193948034 GGCTCTGTTGCCAGGCTGGAGGG + Intergenic
967864187 3:194176748-194176770 GGAGCTGTTGTCAGAGGTGCGGG + Intergenic
968727192 4:2253236-2253258 GGCGGTGTTTCCACAGGGGCAGG - Intronic
968822420 4:2864740-2864762 GGCGCTGATGTCAGCAGGGAAGG + Intronic
968887155 4:3341162-3341184 GGGGCTGTGGGCGGAGGGGAGGG + Intronic
968969688 4:3787261-3787283 TCAGCGGTTGCCAGAGGGGAGGG - Intergenic
969507512 4:7597400-7597422 GGGGCTGTTGCAATAGGAGAGGG + Intronic
969507530 4:7597479-7597501 GGGGCTATTGCAATAGGGGAGGG + Intronic
969507546 4:7597553-7597575 GGAGCTGTTGCAATAGGGGAAGG + Intronic
969507552 4:7597574-7597596 GGGGCTGTTGCAATAAGGGAGGG + Intronic
969516104 4:7649027-7649049 GGCCCAGGTGCCAGAGAGGACGG - Intronic
970115060 4:12685670-12685692 GAAGGTGTAGCCAGAGGGGAGGG - Intergenic
970441204 4:16082750-16082772 GGCGATCTTGCCAGAGAGAAGGG + Intronic
971028011 4:22607558-22607580 TGTGCAGTTGGCAGAGGGGAGGG + Intergenic
971302965 4:25456918-25456940 GGCAGTGTTGACAGAGAGGAGGG - Intergenic
973956490 4:56068328-56068350 GCCGCTGCAGCCTGAGGGGAGGG + Intergenic
979076289 4:116275132-116275154 GGCACTGTGGCCAGTGGGGCTGG - Intergenic
980972587 4:139580972-139580994 TGGGCTGTTACAAGAGGGGATGG - Intronic
983891481 4:173034499-173034521 GGAGATGTTGTCAGAGGTGATGG - Intronic
985719319 5:1481080-1481102 GGCGCTGCAGCCAGGGGGAAGGG + Intronic
985961719 5:3307612-3307634 GGAGCTGAAGCCAGAGGTGAGGG + Intergenic
986132219 5:4942329-4942351 GGCGCCGTCTCCAGAGGGGAGGG - Intergenic
989155331 5:38339488-38339510 GGTGCTGCTGCCAGAAGGCACGG - Intronic
993398652 5:87421699-87421721 GAGGCTGTTTCCACAGGGGATGG + Intergenic
993664869 5:90683662-90683684 TGTGATGTTGCCAGAGGTGAAGG - Exonic
995297663 5:110539510-110539532 GACTCTGGTGCCAGAGGGAATGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997532457 5:134590441-134590463 GGGGCTGTGGTCAGAGGGCAAGG + Intergenic
998065969 5:139159027-139159049 AGCCCTGTTGCCAGGGGGAATGG - Intronic
998485393 5:142497744-142497766 GACGCTGTCGAAAGAGGGGAGGG - Intergenic
999059716 5:148620346-148620368 GGCAGTGTTTCCAGTGGGGATGG + Intronic
999477028 5:151909825-151909847 GGAACTGTGGCCAGAGGGAAAGG - Intronic
1002640861 5:180630075-180630097 GGTGCTGTGGCCAGACGGGCAGG - Exonic
1003329355 6:5116965-5116987 GGCGCAGTTGCCAGGGGAGTGGG + Intronic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1004463699 6:15863071-15863093 GATGGTGATGCCAGAGGGGAGGG + Intergenic
1004660726 6:17706807-17706829 GGCGCTGTGCGCACAGGGGAGGG - Exonic
1005870768 6:29972799-29972821 GAAGGTCTTGCCAGAGGGGAGGG + Intergenic
1006059524 6:31410196-31410218 GAAGGTCTTGCCAGAGGGGATGG - Intronic
1007437256 6:41823734-41823756 GGAGCTGTTCCATGAGGGGAAGG - Intronic
1007687310 6:43674524-43674546 TGTGCTGATGCCAGAGAGGAGGG + Intronic
1007830565 6:44635180-44635202 GGGGCTGTTGACAGTGGGGGAGG - Intergenic
1007909613 6:45500644-45500666 GGCGCTGTTGCCAGGGTGAATGG + Intronic
1010548750 6:77192712-77192734 GGCACTGTGAGCAGAGGGGATGG + Intergenic
1014623197 6:123694891-123694913 GGCCATGTTGGCAGAGGGGCAGG + Intergenic
1017988013 6:159461415-159461437 GGGGCTGTTTACAGAGAGGAGGG - Intergenic
1018977049 6:168573921-168573943 GTCGCTGTGGCCAGTGGGGTAGG + Intronic
1019449571 7:1090392-1090414 GGCTCTGCCGCCAGTGGGGAGGG - Intronic
1019449603 7:1090489-1090511 GGCTCTGCCGCCAGTGGGGAGGG - Intronic
1019449650 7:1090635-1090657 GGCTCTGCCGCCAGTGGGGAGGG - Intronic
1020046714 7:5046071-5046093 GGCGCTGGGGCCAGAGGGGCCGG + Exonic
1020105336 7:5420107-5420129 GCCGCTGCAGCCAGAGGGGTGGG - Intronic
1023186143 7:37535300-37535322 GTCTCTGTTGCCAGAAGGGTCGG + Intergenic
1024742107 7:52365589-52365611 GGCCTTGTTGTCAGAGGGAAAGG + Intergenic
1026461757 7:70620836-70620858 TGATCTGGTGCCAGAGGGGACGG - Intronic
1027116561 7:75486067-75486089 GGCGCTGGGGCCAGAGGGGCCGG - Exonic
1027121888 7:75527888-75527910 GGCGCTGGGGCCAGAGGGGCCGG - Intergenic
1027275240 7:76549543-76549565 GGCGCTGGGGCCAGAGGGGCCGG + Intergenic
1029720949 7:102364093-102364115 GGCGCTGGGGCCAGAGGGGCCGG + Exonic
1032246498 7:130218039-130218061 GGCGCAGATCCCAGAGGAGAGGG + Intergenic
1033283662 7:140023008-140023030 GGCCCTGTTGGCAGAGGGGCTGG - Intergenic
1033420550 7:141201161-141201183 GGTGCTGTCACCCGAGGGGATGG - Intronic
1034411007 7:150942224-150942246 GGAGCTGTGGCAAGAGAGGAAGG - Intergenic
1034490459 7:151390420-151390442 GACGCTGTGGGCAGAGGGGATGG + Intronic
1035038699 7:155911923-155911945 GGTGCTGTAGCAAGAGGGCATGG - Intergenic
1035137002 7:156713451-156713473 GGAGATGTTGGCAGTGGGGAAGG + Intronic
1035737491 8:1898928-1898950 GCCTCTGTGCCCAGAGGGGATGG + Intronic
1044546262 8:93463607-93463629 GGCACTGTTACCATAGGCGATGG - Intergenic
1047196330 8:122725277-122725299 GGTGCTGTTACCAGAGGGAAAGG + Intergenic
1047958287 8:129992425-129992447 AGCGCTGTTCCAAGAGGGGGTGG - Intronic
1048346496 8:133579606-133579628 GGCACTGTTACCTTAGGGGATGG - Intergenic
1049024930 8:139981796-139981818 GGCTCTGCTGCGAGAGGGGCAGG - Intronic
1049720095 8:144111709-144111731 GGCGCTGCTGCCAGGAGGGTGGG - Exonic
1051079425 9:13278720-13278742 GGCGCCGGTGCCAGGGGTGAGGG + Intronic
1051155046 9:14133574-14133596 GGCTCTGTTCCCAGAGGACAAGG + Intronic
1053307894 9:36996730-36996752 GGAGCTATGGCCAGAGGGAAGGG - Intronic
1056442829 9:86637648-86637670 GGCGCTCTTGCCCGTGGGGGTGG + Intergenic
1057219248 9:93247219-93247241 GGGGCTGGTGGCAGACGGGAAGG - Intronic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1058885146 9:109317318-109317340 GGTGCTGTGGCCGGATGGGATGG - Intronic
1059755431 9:117289159-117289181 GACTCTGTTCCCTGAGGGGAGGG + Intronic
1060106926 9:120878410-120878432 GGCGCTGTGGACTGAGGGCAAGG - Intronic
1061205796 9:129162581-129162603 GGTTCTGTTGCCAGAGGAGAGGG - Intergenic
1062184116 9:135207557-135207579 GAAGGTGTTGCCAGAGGAGATGG + Intergenic
1062355003 9:136157786-136157808 GGAGCTGGGGCCAGAGGGGAGGG + Intergenic
1062444288 9:136587230-136587252 GGGACTGTTGCCCGTGGGGAGGG - Intergenic
1186428427 X:9483783-9483805 GGTGATTCTGCCAGAGGGGAAGG - Intronic
1189934335 X:46051610-46051632 GGGGATGTTGCTAGAGGGGGAGG + Intergenic
1192537072 X:71937267-71937289 GGGGCTGTAGCCAGGGTGGAGGG + Intergenic
1200022854 X:153226384-153226406 GGCGATGTGGTCAGAGGTGAAGG + Intergenic
1200235458 X:154465866-154465888 GGCCCTGTTGGCAGTGGGCAGGG - Intronic
1201283481 Y:12360268-12360290 GGAGCCCCTGCCAGAGGGGAAGG + Intergenic